ID: 986836182

View in Genome Browser
Species Human (GRCh38)
Location 5:11640417-11640439
Sequence TCCCTAAGGTTGCCACACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986836180_986836182 -6 Left 986836180 5:11640400-11640422 CCTTAGCAATTAAGAATTCCCTA 0: 1
1: 0
2: 2
3: 10
4: 168
Right 986836182 5:11640417-11640439 TCCCTAAGGTTGCCACACACTGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986836182 Original CRISPR TCCCTAAGGTTGCCACACAC TGG Intronic
903801239 1:25969958-25969980 ACCCTAAGGTCTCCAAACACAGG + Intronic
904365889 1:30010667-30010689 TCCCCAAGGTTGCCCCACGCCGG - Intergenic
905283262 1:36862672-36862694 TCCCTGAGGTGGCCAGACATGGG + Intronic
906180020 1:43810213-43810235 GCCCCAAGGATGCCAAACACAGG + Intronic
906807379 1:48792382-48792404 TTCCTAGGGATGCCACAAACTGG - Intronic
915932185 1:160067678-160067700 TCCCTAAGCTTTCCAGCCACAGG - Intronic
917932059 1:179829305-179829327 TCACTAAGGTTTCCCCACAGTGG + Intergenic
918932379 1:190871519-190871541 TGCCTAAGATGGGCACACACAGG + Intergenic
922491534 1:226020947-226020969 TCCCTCAGGTTTCCTCAGACTGG - Intergenic
923553569 1:234983357-234983379 TCCATCAGGTTGCCACACAGGGG - Intergenic
1063675703 10:8139355-8139377 TTCCTAAGGTGACCACACAGGGG - Intergenic
1073047315 10:100647298-100647320 CCCCTAAGGCTGTCACAGACTGG + Intergenic
1075379900 10:122010678-122010700 TCCCAAAGGATGCCACACGAGGG - Intronic
1075456061 10:122585790-122585812 TCCCTAACCTGGGCACACACAGG - Intronic
1115584099 14:34792569-34792591 TCTTTAAGGTTGTCAGACACAGG + Intronic
1116683723 14:48011239-48011261 TCCCCATGGGTGCCTCACACAGG - Intergenic
1116963017 14:50986253-50986275 TCCCACAGGGTGCCACACTCAGG + Intronic
1118775524 14:68971721-68971743 TCCCTAGGCCTGCCACCCACAGG - Intronic
1122601821 14:102925390-102925412 ACCCAAAAGCTGCCACACACTGG + Intronic
1123499237 15:20865735-20865757 TCTCTGAGGTTTCCACACCCAGG + Intronic
1123556472 15:21439354-21439376 TCTCTGAGGTTTCCACACCCAGG + Intronic
1123592713 15:21876700-21876722 TCTCTGAGGTTTCCACACCCAGG + Intergenic
1124968927 15:34465248-34465270 TCAGGAAGGTTGCCATACACTGG - Intergenic
1127764665 15:62173316-62173338 TTCCTGAGGTTGCTCCACACTGG + Intergenic
1128340858 15:66821687-66821709 TCCTTGAGGTTCCCAGACACTGG - Intergenic
1130052705 15:80497108-80497130 TCCCTAAGGTTTCCATCCTCTGG + Intronic
1131249166 15:90819516-90819538 TCCCCATGGGTCCCACACACAGG + Intergenic
1202964814 15_KI270727v1_random:166543-166565 TCTCTGAGGTTTCCACACCCAGG + Intergenic
1137298202 16:47118252-47118274 TCCCTGAGTGTGTCACACACTGG - Intronic
1142138985 16:88464251-88464273 TGCCTAAGGTTGAGACCCACAGG + Intronic
1143902852 17:10187210-10187232 TCCCTGAGCATTCCACACACTGG + Intronic
1145977406 17:28992481-28992503 TGCCCAAGGATGCCACACCCTGG + Intronic
1146322411 17:31857360-31857382 TCCCTGCGGTTGCCACCCCCAGG + Intronic
1147905231 17:43818206-43818228 TCCCACAGGTGGGCACACACTGG + Intronic
1152420029 17:80187725-80187747 TCCCCAGGGCTGCCACACCCAGG + Intronic
1153254720 18:3159155-3159177 TCCGTAAGTCTGCCACCCACAGG - Intronic
1154457280 18:14542489-14542511 TCTCTGAGGTTTCCACACCCAGG + Intronic
1157599838 18:48887152-48887174 CTCCTGAGGTTGACACACACAGG + Intergenic
1159380507 18:67651376-67651398 TCCCTGAGTCTGCCACACATTGG - Intergenic
1166068958 19:40376805-40376827 TCCCTAGGACTGCCCCACACAGG - Intronic
1168188265 19:54716103-54716125 TCCCTAGGGTCCACACACACAGG - Intergenic
926019476 2:9482767-9482789 TGCCAAGGGGTGCCACACACCGG + Intronic
926216558 2:10909240-10909262 TCTCTAAGGATGTCACCCACTGG - Intergenic
926849754 2:17182275-17182297 TGACTAAGATTGCCAGACACTGG - Intergenic
927620375 2:24650369-24650391 TCCCTAAGGGGGCCAGACATTGG + Intronic
928243834 2:29609989-29610011 TCCCTAAAGCTTCCACACATTGG + Intronic
939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG + Intergenic
940004057 2:148995232-148995254 TCCCTCAGGATGCCACACAGTGG - Intronic
941203956 2:162548292-162548314 TCCCTAAGGCTGCCAGAGGCAGG + Intronic
942383554 2:175418772-175418794 TCCACAATGTTGACACACACAGG + Intergenic
945415190 2:209562358-209562380 TCACAAAGGTAGCTACACACTGG + Intronic
947747090 2:232513413-232513435 TTGCTAAGGTAGCCACACAAAGG - Intergenic
947752160 2:232538814-232538836 TCCCTAAGCTTCCCCCTCACTGG - Intergenic
1173130095 20:40384247-40384269 TCTTTAAGGTGGTCACACACAGG - Intergenic
1173195063 20:40907281-40907303 TCCCTAAATTGGCCACCCACTGG - Intergenic
1173875958 20:46371689-46371711 TCCCTGGGGTGGACACACACTGG + Exonic
1174287947 20:49485126-49485148 TCTCTAAGGATGCCACAGATGGG + Intergenic
1176816879 21:13610864-13610886 TCTCTGAGGTTTCCACACCCAGG - Intronic
1180173917 21:46078364-46078386 CCCCTGAGGCTGCCCCACACCGG - Intergenic
1180988581 22:19920000-19920022 TCCCCCAGGTAGCCACTCACCGG + Intronic
1181304601 22:21908091-21908113 TCCCTGAGCTTATCACACACAGG + Intergenic
1182434285 22:30320388-30320410 TCCCTGAGGTCCCCACACCCAGG - Intronic
1185267959 22:49914447-49914469 TCCCAAAGGTGGCACCACACTGG + Intronic
950003492 3:9676059-9676081 TCCCTGAGGTGGCCTCAGACAGG + Intronic
950794678 3:15501299-15501321 TCCCTGCTGCTGCCACACACAGG + Intronic
950868503 3:16208993-16209015 CATCTCAGGTTGCCACACACTGG - Intronic
956322511 3:68013466-68013488 TCCCTAAGGTTTTCAGTCACAGG + Intronic
958682895 3:97353626-97353648 TCCCTAAGGTTTCCAACTACAGG + Intronic
961884284 3:130085795-130085817 ACCCTCAGGTTGCCCCTCACTGG - Intronic
965024551 3:163283712-163283734 TCCCCATGGTTGTCTCACACAGG + Intergenic
983080474 4:163379589-163379611 CACCTAAGGTGGCTACACACAGG + Intergenic
984060441 4:174983297-174983319 TCCCTAAGCCTGTCACAAACGGG - Intergenic
986836182 5:11640417-11640439 TCCCTAAGGTTGCCACACACTGG + Intronic
988078352 5:26382385-26382407 TCTCTAAGGGGGCCCCACACCGG - Intergenic
988726386 5:33930466-33930488 TCCCCAAGGTTGCAAACCACTGG - Intergenic
996028487 5:118678727-118678749 TTCCAAAGGGTGCCTCACACGGG + Intergenic
999229888 5:150055486-150055508 AGCCTAAGCCTGCCACACACTGG - Intronic
1003138090 6:3448437-3448459 GTCCTGAGGTTGCCACAAACTGG - Intronic
1003654318 6:7991672-7991694 TCCATCTGGTGGCCACACACAGG - Intronic
1006042029 6:31264299-31264321 TCCCTAAGTCTGCTAAACACAGG + Intergenic
1006425899 6:33962876-33962898 CCCCTCAGGTTGCCACACCCAGG + Intergenic
1007292097 6:40795577-40795599 GCCCTATGGTTGCCACAAACAGG + Intergenic
1025635477 7:63316615-63316637 TCTCTAACTTTGCCACCCACTGG + Intergenic
1025647218 7:63431555-63431577 TCTCTAACTTTGCCACCCACTGG - Intergenic
1026834104 7:73626821-73626843 TCCCTAACATGACCACACACAGG - Intergenic
1028266515 7:88733153-88733175 TCCCTAAGGTTTCCAACCCCAGG - Intergenic
1028284862 7:88983076-88983098 TCCCTAAGGTTGAAAATCACAGG - Intronic
1029673705 7:102051289-102051311 GCCCTAAGTTTGCAAAACACAGG + Intronic
1032865361 7:135919288-135919310 TCCATAAGATTGCCAAACGCAGG + Intergenic
1036429323 8:8675197-8675219 TCCCTGAGGTTGTCACACCGTGG - Intergenic
1037522839 8:19697031-19697053 TTCCTATGGATGGCACACACAGG - Intronic
1040472291 8:47744330-47744352 TCCCTGAGGAAGCCAGACACTGG + Intergenic
1040561001 8:48523480-48523502 TCCCTAAGGCTCCCGCACAGAGG + Intergenic
1043304200 8:78773664-78773686 TTCCTTAGGTTACCACTCACTGG - Intronic
1046583512 8:116122855-116122877 TCCTTAAGCTTGCCAGACACAGG - Intergenic
1047072764 8:121365388-121365410 ACCCAAAGCTTGCCACACATTGG + Intergenic
1055785082 9:79863274-79863296 TCCCGAAGGTTGCTGCACCCAGG + Intergenic
1057173231 9:92976302-92976324 GCCCTAGGGATGCCAGACACTGG + Exonic
1057885999 9:98830254-98830276 TCCCTAAGGTGGCCCCAGACAGG + Intronic
1061827897 9:133273387-133273409 TCCCCCAGATTTCCACACACTGG + Intronic
1062346071 9:136115905-136115927 CCCCTCAGGATGACACACACAGG + Exonic
1203530484 Un_GL000213v1:138630-138652 TCTCTGAGGTTTCCACACCCAGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1199243928 X:145580650-145580672 TCCCTAAGGTTGACAAATTCAGG - Intergenic
1200170189 X:154067212-154067234 TGCCAAAGGTTGCCAACCACTGG + Intronic