ID: 986841411

View in Genome Browser
Species Human (GRCh38)
Location 5:11701960-11701982
Sequence GCTTCCCATGATGAGTTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986841411_986841416 10 Left 986841411 5:11701960-11701982 CCACATAACTCATCATGGGAAGC 0: 1
1: 0
2: 0
3: 13
4: 137
Right 986841416 5:11701993-11702015 CAAAGGCTTGGAAAGCACTCGGG 0: 1
1: 0
2: 3
3: 18
4: 186
986841411_986841415 9 Left 986841411 5:11701960-11701982 CCACATAACTCATCATGGGAAGC 0: 1
1: 0
2: 0
3: 13
4: 137
Right 986841415 5:11701992-11702014 GCAAAGGCTTGGAAAGCACTCGG 0: 1
1: 0
2: 2
3: 27
4: 255
986841411_986841413 -7 Left 986841411 5:11701960-11701982 CCACATAACTCATCATGGGAAGC 0: 1
1: 0
2: 0
3: 13
4: 137
Right 986841413 5:11701976-11701998 GGGAAGCAGGACACAAGCAAAGG No data
986841411_986841418 18 Left 986841411 5:11701960-11701982 CCACATAACTCATCATGGGAAGC 0: 1
1: 0
2: 0
3: 13
4: 137
Right 986841418 5:11702001-11702023 TGGAAAGCACTCGGGCAGTTGGG No data
986841411_986841414 -2 Left 986841411 5:11701960-11701982 CCACATAACTCATCATGGGAAGC 0: 1
1: 0
2: 0
3: 13
4: 137
Right 986841414 5:11701981-11702003 GCAGGACACAAGCAAAGGCTTGG 0: 1
1: 0
2: 1
3: 17
4: 298
986841411_986841417 17 Left 986841411 5:11701960-11701982 CCACATAACTCATCATGGGAAGC 0: 1
1: 0
2: 0
3: 13
4: 137
Right 986841417 5:11702000-11702022 TTGGAAAGCACTCGGGCAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986841411 Original CRISPR GCTTCCCATGATGAGTTATG TGG (reversed) Intronic
904883071 1:33715094-33715116 GCTTCCCAGGAGGATTTCTGAGG + Intronic
907511376 1:54963538-54963560 GCCTCCCATGAAGATTTATGGGG + Intergenic
908860323 1:68478905-68478927 CCTTCACATGATGAGGAATGTGG - Intronic
909547786 1:76867590-76867612 GGTTTCCATGATGGGTAATGGGG - Exonic
916626207 1:166558035-166558057 GCCTCCCATAAAGATTTATGGGG + Intergenic
923012404 1:230098863-230098885 GTTGACCATGATGTGTTATGAGG + Intronic
924297177 1:242599288-242599310 GCCTCCCAGGAAGATTTATGGGG + Intergenic
1071199489 10:83203023-83203045 GCTTCACAGAATGAGTTAGGGGG + Intergenic
1071796269 10:89009621-89009643 GCTTCCCAAGATGACTTACAAGG - Intronic
1073994611 10:109301197-109301219 GCCTCCCATAAAGATTTATGGGG - Intergenic
1076654531 10:132014832-132014854 GCCTCCCATAAAGATTTATGGGG + Intergenic
1077853384 11:6097054-6097076 GCCTGCCATGGTGAGTGATGGGG - Intergenic
1078492764 11:11784712-11784734 GCTGCCCCTGATGAGTTTTTTGG - Intergenic
1079187112 11:18247687-18247709 GCTTCTCAGGATGTGTTAAGTGG - Intronic
1079189691 11:18267190-18267212 GCTTCTCAGGATGTGTTAAGTGG + Intronic
1079794403 11:24781632-24781654 TATTACCATGATGTGTTATGAGG - Intronic
1082778526 11:57267783-57267805 GCCTCCCATAAAGATTTATGGGG + Intergenic
1084201163 11:67559434-67559456 GCTTTCTTTGATGAGTTCTGGGG + Intergenic
1084698968 11:70773724-70773746 GCTTCACATCATTAGTTATTAGG + Intronic
1085483705 11:76843793-76843815 GCCTCCCATAAAGATTTATGGGG + Intergenic
1086414573 11:86576064-86576086 GCTTCAAATGCTGATTTATGAGG + Intronic
1086783121 11:90931443-90931465 CCTTCCCATGAGGAGTTGAGAGG + Intergenic
1087129617 11:94656996-94657018 GCTTCCCATAAAGATTTATGGGG + Intergenic
1087217539 11:95510157-95510179 GCTTCACATTATGATCTATGAGG + Intergenic
1088974543 11:114803988-114804010 GCTTCAAAATATGAGTTATGGGG + Intergenic
1089982226 11:122781651-122781673 GCTTCCCATGCTGGGTAATAAGG - Intronic
1091759699 12:3078503-3078525 GCTTGCCATCATAAGTAATGGGG + Intronic
1098503464 12:71221939-71221961 GACTCCCATGATGAGATATGTGG + Intronic
1099993018 12:89746603-89746625 TCTTCCATTGATGATTTATGGGG + Intergenic
1100083867 12:90883374-90883396 CCTTTCCATGATGTGTTATTTGG - Intergenic
1100407738 12:94285793-94285815 GCTTGTCTTGATGAGTTAGGAGG + Intronic
1100577186 12:95903892-95903914 GCTTCACAGCATGAGTTGTGAGG + Intronic
1101306227 12:103530506-103530528 GCTTCTCATTATGAGGCATGAGG + Intergenic
1101905295 12:108820294-108820316 GCTTCCTATGATGAGCGATTTGG + Intronic
1103804426 12:123561278-123561300 GTTTCCCAAGATGGGTTTTGGGG - Intergenic
1104351671 12:128049450-128049472 TCATCCCAAGATGAGTTGTGAGG + Intergenic
1104998857 12:132675642-132675664 GCTTCCCATGTCGACTTAGGAGG - Intronic
1105365151 13:19757474-19757496 GCCTCCCATAAAGATTTATGAGG + Intronic
1106624504 13:31406691-31406713 GCCTCCCATAAAGATTTATGGGG + Intergenic
1107568150 13:41627870-41627892 CCTTCCCATAAAGATTTATGAGG + Intronic
1110738935 13:78971511-78971533 GTTTCCCATATTGAGTTATTTGG - Intergenic
1112854954 13:103757158-103757180 CCTTCCCATGTTGAATCATGGGG - Intergenic
1113273692 13:108704395-108704417 GGTTTCCATGATGAGTTAATGGG + Intronic
1115469849 14:33757180-33757202 GCTTTTCATGATGAGCTAAGTGG + Intronic
1115543977 14:34448382-34448404 GCCTCCCATAAAGATTTATGGGG + Intronic
1116493120 14:45528994-45529016 GCTTCATAGAATGAGTTATGAGG - Intergenic
1116576421 14:46581637-46581659 GCCTCCCATAAAGATTTATGGGG - Intergenic
1120232037 14:81850405-81850427 GCCTCCCATAAAGATTTATGGGG - Intergenic
1123573874 15:21645458-21645480 GCTTCCAATTTTGAGGTATGGGG + Intergenic
1123610492 15:22088043-22088065 GCTTCCAATTTTGAGGTATGGGG + Intergenic
1125630578 15:41143771-41143793 GCCTCCCATAAAGATTTATGGGG - Intergenic
1129260438 15:74364307-74364329 GCCTCCCATAAAGATTTATGGGG + Intronic
1131183427 15:90255899-90255921 GCTTCCCATGCTGAGATACCAGG + Intronic
1131506303 15:93022726-93022748 GCTTCCCAAGGTGAGGGATGGGG - Intronic
1136290105 16:29266591-29266613 GCTGCCTATGATGATTTAAGGGG + Intergenic
1139121055 16:64017538-64017560 GCCTCCCACGCTGAGCTATGTGG - Intergenic
1139921118 16:70461279-70461301 TTTTCCCATGCTGAGTTTTGAGG + Intronic
1141324064 16:83039113-83039135 GGTTCCCACGGAGAGTTATGAGG + Intronic
1142095988 16:88240113-88240135 GCTGCCTATGATGATTTAAGGGG + Intergenic
1143958296 17:10692881-10692903 GCTCCCCAGTATGAGTTGTGAGG + Exonic
1146038643 17:29430736-29430758 GCCTCCCATAAAGATTTATGGGG - Intronic
1146444898 17:32925935-32925957 GCATCCCATAAAGATTTATGGGG + Intergenic
1146745131 17:35321927-35321949 GCCTCCCATAAAGATTTATGGGG + Intergenic
1153846736 18:9056946-9056968 GCTTCTCAAGCTGAGTTCTGAGG + Intergenic
1155368231 18:25070748-25070770 GCTTCCCACCAAGAGATATGTGG - Intronic
1157013190 18:43677737-43677759 GCCTCCCATAAAGATTTATGGGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162629611 19:11916793-11916815 GCTTCCCATGATGACTTAGATGG - Intergenic
1162634663 19:11958023-11958045 GCTTCCCATGGTGAATTAGATGG - Intronic
1163870336 19:19816041-19816063 CCTTCCCATTATGAGTTAGATGG + Intronic
1163905033 19:20144775-20144797 CCTTCCCATTATGACTTAAGTGG + Intergenic
1164461488 19:28452783-28452805 GCCTCCCATGAAGACCTATGGGG + Intergenic
1165338659 19:35194257-35194279 GCTTCCTATGAAGAGCCATGAGG + Intergenic
1168603194 19:57736903-57736925 ACTTACCAAGATGAATTATGAGG + Intronic
928179690 2:29059819-29059841 CTTTCCCATGTTGAGTCATGAGG - Exonic
931116292 2:59170284-59170306 GCTGTCCATGATGTGTCATGGGG - Intergenic
931444338 2:62314232-62314254 GCTTACCAAGATGAATAATGAGG + Intergenic
932568910 2:72926853-72926875 GCTCCGTATGATAAGTTATGAGG - Intronic
936500103 2:113059981-113060003 ACTTCCCATGATGTGTTCTATGG + Intronic
937375854 2:121335236-121335258 TCCTCCCATGCTGAGTTAGGTGG + Intergenic
938658689 2:133463601-133463623 GCTTCTCATGCTGAGAAATGGGG - Intronic
940376305 2:152962839-152962861 GCCTCCCATAAAGATTTATGGGG - Intergenic
947800262 2:232925194-232925216 GCTTCCTAAGATGATTAATGGGG - Intronic
947905906 2:233762106-233762128 GCTTCACATCATGAGCCATGTGG + Intronic
947980645 2:234405850-234405872 CCTTCCTATGATGAGTGATGGGG + Intergenic
1168807297 20:679531-679553 GCTTCCTTTGATCAGTTAAGGGG - Intergenic
1169423897 20:5481497-5481519 GCCTCCCATAAAGATTTATGGGG - Intergenic
1170160509 20:13305449-13305471 GCTTCCCAGGAAGTGTTGTGGGG + Intergenic
1170678009 20:18500093-18500115 GCCTCCCATAAAGATTTATGGGG + Intergenic
1172495227 20:35377358-35377380 GCTTCCCAAGATGTGTTCTGTGG - Intronic
1175970570 20:62684762-62684784 GGCTGCCCTGATGAGTTATGGGG - Intronic
1178423806 21:32462890-32462912 GCTTGCTGTGATGATTTATGTGG + Intronic
1179123433 21:38569724-38569746 AATTCCAATGCTGAGTTATGTGG + Intronic
949176167 3:1065285-1065307 GCTTCCAATGAAGAATCATGAGG - Intergenic
951841403 3:27038069-27038091 GCCTCCCATAAAGATTTATGGGG - Intergenic
955945208 3:64187341-64187363 GCTTCCCAAGAAGAGTGAGGTGG + Intronic
956705450 3:71995304-71995326 TCCTCTCATGATGAGTGATGAGG - Intergenic
961972830 3:130988645-130988667 GCCTCCCATAAAGATTTATGGGG + Intronic
972063879 4:34914864-34914886 GCTTCACAGAATGAGTTAAGAGG - Intergenic
974189690 4:58488764-58488786 GCCTCCCATAAAGATTTATGGGG - Intergenic
974649469 4:64735308-64735330 GCCTCCCATGAAGATTTATGGGG + Intergenic
979669869 4:123350922-123350944 GCCTACCATGATGGGTTGTGTGG - Intergenic
980091865 4:128451288-128451310 GCTTCCAATCATGAGGTATTTGG + Intergenic
980936857 4:139233824-139233846 GCTTCCTATAAAGATTTATGAGG - Intergenic
986826037 5:11524005-11524027 TCTGCCCATGATGATTTATGAGG - Intronic
986841411 5:11701960-11701982 GCTTCCCATGATGAGTTATGTGG - Intronic
987841742 5:23231365-23231387 GCCTCCCATAAAGATTTATGGGG - Intergenic
988098462 5:26647739-26647761 CTATCCCATGATGAGTTCTGGGG - Intergenic
988700163 5:33665826-33665848 GCCTCCCATAAAGATTTATGGGG + Intronic
989738293 5:44735905-44735927 GTTTCCCATAATTTGTTATGTGG - Intergenic
991194359 5:63915280-63915302 GCTTACTATGCTGATTTATGAGG - Intergenic
993489499 5:88529156-88529178 GCTCACCATTATTAGTTATGTGG - Intergenic
994236908 5:97373524-97373546 GCTTCATATAATGAGTTAAGGGG - Intergenic
995298056 5:110542616-110542638 GCTCCCCATAAAGATTTATGGGG + Intronic
999398425 5:151245876-151245898 GCCTCCCATAAAGATTTATGGGG - Intronic
1001095977 5:168775802-168775824 GCTTCCTATGATGATTTTTTAGG - Intronic
1005639529 6:27782913-27782935 GCCTCCCATAAAGATTTATGGGG + Intergenic
1006868132 6:37225769-37225791 GCTTCCCTTGCTGATTTGTGTGG + Intronic
1007579945 6:42951904-42951926 GCCTCCCATAAAGATTTATGGGG - Intergenic
1007996865 6:46316927-46316949 TTTTCCCATTATGAGTTGTGTGG + Intronic
1009740393 6:67735608-67735630 GCTTCACATTATTAGTCATGAGG + Intergenic
1011547091 6:88493507-88493529 GCTTCCCATTAGCAGTTATATGG + Intergenic
1017378336 6:153797408-153797430 GCGTCCCATAACGATTTATGGGG - Intergenic
1017978935 6:159381687-159381709 GCTTCACAGAATGAGTTCTGTGG + Intergenic
1020441814 7:8224973-8224995 GCTTGACATCATGAGTGATGAGG - Intronic
1021073186 7:16268523-16268545 CTTTCCCATTATGACTTATGAGG + Intronic
1021932754 7:25597948-25597970 GCTTTCCATGATGATTTCTGGGG - Intergenic
1022256167 7:28660779-28660801 ACTTCCCAGAATGAGTTGTGAGG - Intronic
1028035495 7:85976590-85976612 ACCTCCCATGAAGATTTATGGGG - Intergenic
1030144881 7:106342851-106342873 GCCTCCCATAAAGATTTATGGGG + Intergenic
1032514913 7:132499672-132499694 GCTCCCCAGGCTGAGTTATGGGG + Intronic
1036732814 8:11281205-11281227 GCCTCCCATAAAGATTTATGGGG - Intergenic
1037770856 8:21798693-21798715 ACATCCCATGGTGAGTTCTGGGG + Intronic
1043259121 8:78175737-78175759 GCCTCCCATAAAGATTTATGGGG - Intergenic
1043458116 8:80432226-80432248 GCCTCCCATAAAGATTTATGGGG - Intergenic
1051028514 9:12645504-12645526 GCTTCACATTCTGAGTGATGGGG - Intergenic
1052916323 9:33926697-33926719 GCTTCCCAGGGTGTGGTATGTGG - Intronic
1053330089 9:37197472-37197494 GCTTGTGATGATGAGTGATGGGG + Intronic
1054804870 9:69388060-69388082 GCTTTCCATGTTGAGTTTTGTGG + Intronic
1058112918 9:101051346-101051368 GCTGCTCATGTTGAGTAATGGGG - Intronic
1060048858 9:120362516-120362538 GGTCCCCATGATGAGATTTGTGG + Intergenic
1061117026 9:128620274-128620296 GCTTCCCATGGTGAGGAAGGTGG - Intronic
1187736592 X:22311203-22311225 GGTCCCCATGATGAGAAATGTGG - Intergenic
1188057713 X:25560871-25560893 GCTTCCACATATGAGTTATGGGG + Intergenic
1188964447 X:36534167-36534189 GCTTCACATAATGAGTTAAGAGG + Intergenic
1189415867 X:40812868-40812890 GCGTCCCATGAAGATTTATGGGG - Intergenic
1190164278 X:48059241-48059263 TCTTCCCAGTATGAGTTATCTGG + Exonic
1190460266 X:50666321-50666343 TTTTACCCTGATGAGTTATGGGG + Intronic
1195230014 X:102837227-102837249 GCTTCCCAAGTGGAGTCATGTGG + Intergenic
1201354731 Y:13084778-13084800 GCCTCCCGTAATGATTTATGGGG - Intergenic
1201576132 Y:15463386-15463408 GCTTTCCAGGATGAGGTGTGAGG + Intergenic