ID: 986846516

View in Genome Browser
Species Human (GRCh38)
Location 5:11762758-11762780
Sequence ACTAGACAGAAGGCAGTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986846516_986846519 0 Left 986846516 5:11762758-11762780 CCCAGTACTGCCTTCTGTCTAGT 0: 1
1: 0
2: 0
3: 15
4: 133
Right 986846519 5:11762781-11762803 TATTTTCTCCTGTTCATATATGG No data
986846516_986846520 6 Left 986846516 5:11762758-11762780 CCCAGTACTGCCTTCTGTCTAGT 0: 1
1: 0
2: 0
3: 15
4: 133
Right 986846520 5:11762787-11762809 CTCCTGTTCATATATGGATTTGG 0: 1
1: 0
2: 1
3: 12
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986846516 Original CRISPR ACTAGACAGAAGGCAGTACT GGG (reversed) Intronic
907384280 1:54115942-54115964 ACCAGAGAGAAGGCAGTATGGGG - Intergenic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
911045018 1:93620878-93620900 TCTAGGCAGAAGGCAGTATCTGG - Intronic
915073081 1:153288486-153288508 ACTAGTCCCAAGGCAGTGCTGGG + Intergenic
915519502 1:156433308-156433330 ACTTCAAAGAAGGCAATACTGGG + Intergenic
915625590 1:157112177-157112199 CCTAGAAAGAAGGAAGAACTGGG - Intergenic
920962446 1:210675602-210675624 AATAAACAGGAGGCAGCACTAGG - Exonic
921882406 1:220270386-220270408 TCTAAACAGTAGGGAGTACTGGG - Intronic
1063971204 10:11382389-11382411 CCCAGTCAGAAGGCAGTGCTGGG + Intergenic
1065251192 10:23816182-23816204 AATACACACAAAGCAGTACTAGG + Intronic
1066591136 10:36995736-36995758 ACTATACACAAAGCATTACTTGG - Intergenic
1068127139 10:52854424-52854446 ACTAGAAAGAAGTCAATACCTGG + Intergenic
1068946504 10:62734812-62734834 ACTCCAAGGAAGGCAGTACTAGG + Intergenic
1070984431 10:80676141-80676163 ACTAGAAAGAAGTCAGTACCTGG + Intergenic
1072075786 10:91971990-91972012 AATACACAGAAGGCAGAAGTAGG - Intronic
1072909556 10:99487672-99487694 ACTAGACAAAAGGAAGAACTGGG - Intergenic
1074800146 10:116991616-116991638 ACTAAAAAGCAGGCATTACTAGG + Intronic
1075407751 10:122205855-122205877 ACGAGATACAAAGCAGTACTTGG - Intronic
1076492800 10:130874709-130874731 CCTATACAGAAGGCAGATCTTGG + Intergenic
1077242169 11:1516352-1516374 CCTAGAAAGCAGCCAGTACTTGG - Intergenic
1081203897 11:40251885-40251907 ACTCCACAGAAGGCAGTCCAAGG - Intronic
1082312965 11:50676817-50676839 ATTGGACACAATGCAGTACTGGG + Intergenic
1083303045 11:61748710-61748732 GGTAGACCGAAGGCAGCACTGGG - Intergenic
1083854728 11:65387041-65387063 ACGGGACAGAAGGCAGTGCCGGG + Exonic
1085730335 11:78992385-78992407 ACAAGAGAGAAGGCAATACTAGG - Intronic
1088855974 11:113754074-113754096 GCTAGACAGAAGTCAATACTTGG + Intronic
1090184253 11:124725878-124725900 ATTAGAGAGAAGGAAGAACTTGG - Intergenic
1090735311 11:129607891-129607913 AAAGGACAGAAGGCAGAACTGGG + Intergenic
1090908632 11:131098636-131098658 ACTATACACTAGGCAGTACTAGG + Intergenic
1092685962 12:11046601-11046623 ACTAGAGAGAGGTCAGCACTTGG - Intronic
1093662132 12:21769097-21769119 ACTAGATAGAAGTCAATGCTTGG + Intronic
1094294311 12:28887151-28887173 TCTAGACACAAGCCATTACTAGG + Intergenic
1095194588 12:39298094-39298116 ACTAGGCAAAAGGCAGTGCGAGG + Intronic
1097311078 12:58119631-58119653 ACTAGACAGCAGGGAGTACCAGG - Intergenic
1098162093 12:67655640-67655662 ACAAAACAGAAGACAATACTTGG - Intronic
1098744198 12:74214769-74214791 GCTAGAGAGAAGTCAGTGCTTGG - Intergenic
1105994201 13:25654609-25654631 ACCAGACAGTGGGCGGTACTGGG + Intronic
1110277102 13:73652817-73652839 AAAAGACAGAAGGAAGTATTAGG + Intergenic
1110719411 13:78744803-78744825 ATTAGACTGAAGACAGTACTAGG - Intergenic
1110727714 13:78844521-78844543 ACTAGATAAAAGTCTGTACTAGG - Intergenic
1111333666 13:86792830-86792852 ACTAGACACAAAGCAGTGATTGG - Intergenic
1112291202 13:98144617-98144639 ATTAAACAGAAGCCAGTGCTAGG - Intronic
1113338586 13:109400421-109400443 ACCAGCCAGGAGGCAGAACTTGG + Intergenic
1113827142 13:113265120-113265142 ACTAGACAGAAGTCAGAGCAGGG + Intronic
1115484935 14:33901464-33901486 CCTAGACTGAAGTGAGTACTGGG - Intergenic
1115740854 14:36386431-36386453 ACTAGAGAGAAGTCAGTGCCTGG + Intergenic
1119785325 14:77309270-77309292 AGTAGACAGAAGGAAGTACAGGG - Intronic
1125209664 15:37198440-37198462 ACAAGACAGACTGCAGTACTAGG + Intergenic
1125675360 15:41499448-41499470 CCCACACAGATGGCAGTACTTGG + Intronic
1125967584 15:43886774-43886796 ACTAGGCCAAAGGCAGGACTAGG + Intronic
1126898225 15:53283087-53283109 AGTTCACAGAAGGCAGAACTGGG + Intergenic
1128157178 15:65398960-65398982 CCTGGAAAGAAAGCAGTACTTGG + Intronic
1130041886 15:80411925-80411947 ACAACACAGAAGGCAGTAAATGG - Intronic
1131886593 15:96922004-96922026 ACTAGACAGAAGACATTTATAGG + Intergenic
1132297363 15:100749811-100749833 ACAAGTGAGAATGCAGTACTTGG + Intergenic
1132787203 16:1664052-1664074 ACTAGAGAGGAGGCACTACTAGG - Intronic
1134612407 16:15619712-15619734 ACTGCAGAGAAGGCAGAACTGGG - Intronic
1138869051 16:60858696-60858718 ACTAGACAGAAAACACTACAAGG + Intergenic
1153456675 18:5290722-5290744 ACTGGACTTAAGGCAGTGCTTGG - Exonic
1153492777 18:5666751-5666773 ACTAGAGAGAAGGCAATGCCTGG - Intergenic
1153752598 18:8248519-8248541 ACTAGACAGAATTCAGCTCTTGG - Intronic
1159080104 18:63726940-63726962 ACTAGGTGGAAGGCAGGACTTGG - Intergenic
926693781 2:15756145-15756167 ACTAGAAACCAGGCAGAACTAGG - Intergenic
929756680 2:44771746-44771768 ACTTGACAGAAGGCAGAGCTGGG - Intronic
930386341 2:50699943-50699965 AGTGGACAGAGTGCAGTACTTGG - Intronic
933243214 2:79946045-79946067 TCTAGGCAGAAGGAAGTACATGG + Intronic
934040691 2:88125587-88125609 CCTAGACTGAAGGCAGTGCAGGG - Intronic
939686233 2:145204192-145204214 ACTAGCCAGCAGGCAATGCTAGG + Intergenic
941634059 2:167916267-167916289 ACAAAAAAGAAGGAAGTACTTGG + Intergenic
948967116 2:241391429-241391451 AATAGACATAAAGCAGTAATGGG + Intronic
1170280177 20:14637555-14637577 ACTATACAGAAGGCACGATTAGG - Intronic
1170969476 20:21104038-21104060 CCTAGACAGAAGTGAGTCCTTGG - Intergenic
1173307552 20:41864354-41864376 ACTAGTCAGCAGGCAGAGCTAGG - Intergenic
1175492573 20:59389165-59389187 ACAAGACAGAAGACAGCTCTAGG + Intergenic
1178196758 21:30354057-30354079 ACTACACAGAAAGCAGTAATAGG - Intronic
1182006331 22:26962705-26962727 ACTAGACAGAGGGCAGGCATTGG - Intergenic
1184683991 22:46087835-46087857 ACCAGACAGAGGCCAGTACCAGG + Intronic
1185084397 22:48731451-48731473 ACTAGAGAGAAGTCAGTGCCTGG + Intronic
950189368 3:10966095-10966117 ACAAGACAGAAGTCGGGACTTGG + Intergenic
956942134 3:74175331-74175353 ACTAGAGAGAAGTCAATACCTGG - Intergenic
957617916 3:82555596-82555618 ACTGGAGAGAAGGCAGTCATTGG - Intergenic
962187872 3:133279292-133279314 CCCAGACAGAAAGCAGGACTTGG - Intronic
962491864 3:135902419-135902441 ACTAGACACAAGGCTGAATTTGG - Intergenic
962947082 3:140181888-140181910 AGGAGAAAGAAGGCAGGACTTGG - Intronic
967011509 3:185439205-185439227 AAGAGACAGAAAGAAGTACTTGG + Intronic
971071257 4:23094846-23094868 GCTAGAGAGAAGTCAGTGCTTGG + Intergenic
971218815 4:24686526-24686548 TATAGGCAGAAGGCAGTACCAGG - Intergenic
971307907 4:25499868-25499890 AGTAGACAGGTGGCAGAACTGGG - Intergenic
971969902 4:33606922-33606944 CCTAGAGAGATGGCCGTACTTGG - Intergenic
972584757 4:40427405-40427427 AGTAGACAGAAGGAAGTAGCAGG - Intronic
976215129 4:82708830-82708852 GCTCGACAGAAGGAAGCACTTGG + Intronic
979786866 4:124726305-124726327 ACTAGATTCAAGGCAGCACTAGG - Intergenic
981540422 4:145840993-145841015 ACTAGACAAAAAGCAGAAGTGGG - Intronic
982097722 4:151938016-151938038 TCTAGATAGCAGGCAGCACTGGG - Intergenic
985879588 5:2628287-2628309 ACCAGAAAGAAGGGAATACTTGG - Intergenic
986752870 5:10805406-10805428 GCTAGAGAGAAGTCAGTGCTTGG + Intergenic
986846516 5:11762758-11762780 ACTAGACAGAAGGCAGTACTGGG - Intronic
987095876 5:14549199-14549221 GCTAGACAGAAGTCAGTGCCTGG - Intergenic
988180809 5:27789205-27789227 ACTTAATAGAAGGCAGTGCTTGG - Intergenic
989511361 5:42291546-42291568 TCTAGAGAGAAGTCAGGACTGGG - Intergenic
991469155 5:66949177-66949199 AGTAGAAAGAATGCAGTAGTTGG + Intronic
992695950 5:79287331-79287353 ACAAGACAGAAGGATGAACTTGG + Intronic
994169342 5:96641605-96641627 ACTAGCCAGAAGGCAGAAGAAGG - Intronic
997567432 5:134900006-134900028 ACTATACAGAAGGCAAAAATAGG + Exonic
1001114054 5:168924067-168924089 ACTAGATAGAAGTCTGTACCCGG + Intronic
1001688419 5:173613865-173613887 ACTAGAAAGAAGGCGTTACTAGG - Intronic
1003138268 6:3450259-3450281 ACTAGACAAAAGCCACCACTGGG + Intronic
1004566756 6:16805199-16805221 ACTATATAGAAGGCATTGCTGGG - Intergenic
1005703256 6:28425730-28425752 ACTAGAGAGAAGTCAGTGCCTGG - Intergenic
1009921662 6:70069330-70069352 ATTTTACAGAAGGCAGAACTGGG - Intronic
1011336037 6:86260638-86260660 ATTAGAAAGAAAGCAATACTAGG - Intergenic
1013477212 6:110520087-110520109 ACTGGACACAAAGCAGTACTTGG - Intergenic
1013602504 6:111718269-111718291 ACAGGACTGAAGGCAGTATTGGG + Intronic
1013922741 6:115428263-115428285 ACTAGAGAGAAGTCAATGCTTGG - Intergenic
1015536247 6:134270226-134270248 ACTAGAGAAAAGACAGTAATAGG - Intronic
1021495189 7:21266745-21266767 TCAAAACAGAAGGCATTACTTGG + Intergenic
1021593855 7:22293800-22293822 AGAAGAGAGAAGGCAATACTCGG + Intronic
1023167357 7:37355973-37355995 ACTAGACAGAGGGTAGTGTTAGG + Intronic
1023250430 7:38254475-38254497 ACTAGACAGAAGTCAGTTTGAGG - Intergenic
1023251733 7:38270573-38270595 ACTAGACAGAAGTCAGTTTCAGG - Intergenic
1023598279 7:41855250-41855272 CCCAGTCAAAAGGCAGTACTTGG - Intergenic
1024613296 7:51085355-51085377 AGTACAAAGAAGGCAGTATTAGG + Intronic
1025507492 7:61456226-61456248 ACTAGACAGAAAGCATTCCCAGG + Intergenic
1028505470 7:91565865-91565887 AACAGACAGAAGGTAGTGCTGGG - Intergenic
1028838793 7:95403507-95403529 ACTAGACAGAAGGGAGAATGAGG - Intergenic
1029171615 7:98633767-98633789 ACATGAAAGAAGGCAGTAATGGG + Intergenic
1029311768 7:99673827-99673849 ACTGGACAGAAGGCGATGCTGGG + Intronic
1031880020 7:127187183-127187205 ACTAGGAAGAAGGCAGTTCTGGG - Intronic
1032613000 7:133436214-133436236 AGAAGTCAGAAGGCAGTACAAGG - Intronic
1034697346 7:153065595-153065617 ACTAGACAGAAGTCAAGACCAGG - Intergenic
1035851460 8:2923060-2923082 CCTAAATAGAAGGCTGTACTGGG - Intergenic
1036933696 8:12980280-12980302 AGAAGACAGAAGGCAGAAATTGG - Intronic
1038152015 8:24950466-24950488 ACTAGGCAGGAGTCAGCACTAGG + Intergenic
1039342442 8:36665682-36665704 AATAGATAGAAGGCAGTTGTTGG - Intergenic
1039443496 8:37611918-37611940 ACTAAACAGGAGGAAGCACTGGG + Intergenic
1040453535 8:47573336-47573358 GCTACAGAGAAGTCAGTACTAGG - Intronic
1040636326 8:49277903-49277925 ACTAGAAAGAAGTCAATGCTTGG + Intergenic
1047106459 8:121736038-121736060 GCTAGAGAGAAGTCAGTGCTTGG - Intergenic
1051601648 9:18880784-18880806 ACTAGAGAGAAGTCAATACCTGG - Intronic
1057843160 9:98502419-98502441 TCTAGAGAGAGGGCAGTACCCGG - Intronic
1059806510 9:117806850-117806872 ACTAGACTAAAGGCAGGATTTGG - Intergenic
1185969422 X:4645899-4645921 ACTGGAAAAAAGGCAGTTCTAGG - Intergenic
1186559529 X:10596318-10596340 ACAAGAAAAAAGACAGTACTTGG - Intronic
1190814206 X:53914605-53914627 GCTAGAGAGAAGGCAGTGCCTGG + Intergenic
1191700571 X:64037800-64037822 AGTAGAGAGAAAGCAGTGCTGGG + Intergenic
1193410923 X:81161898-81161920 ATTATAAAGAATGCAGTACTTGG + Intronic
1196991833 X:121337843-121337865 ACTAGGCAGCAGGCAGAATTTGG - Intergenic
1198513201 X:137374886-137374908 ATAAGCCCGAAGGCAGTACTTGG - Intergenic
1199887040 X:152030506-152030528 TCTGGACATAAAGCAGTACTTGG - Intergenic