ID: 986854920

View in Genome Browser
Species Human (GRCh38)
Location 5:11857327-11857349
Sequence GTGGCGATACAAAGGCACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986854908_986854920 28 Left 986854908 5:11857276-11857298 CCATATCAAGGTACAAAGCTCTG 0: 1
1: 0
2: 0
3: 17
4: 104
Right 986854920 5:11857327-11857349 GTGGCGATACAAAGGCACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986854920 Original CRISPR GTGGCGATACAAAGGCACCG AGG Intronic
900002345 1:21617-21639 GTGGGGACACAAAGGAACCAGGG + Intergenic
900022064 1:192141-192163 GTGGGGACACAAAGGAACCAGGG + Intergenic
901017965 1:6242480-6242502 GGCGCGGTATAAAGGCACCGCGG - Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
916749834 1:167714075-167714097 ATGGAGATACAATGGCACCTAGG + Intergenic
920787194 1:209052437-209052459 GTGGTGAAACAAAGGCACTCTGG - Intergenic
1068931774 10:62597225-62597247 GAGGTGATACAAAGGCCCGGGGG + Intronic
1069910851 10:71758312-71758334 CTGGAGATACAAAGGCATCCAGG - Intronic
1070933476 10:80276654-80276676 GTGGCCAGACACAGGCACCCAGG + Intronic
1072744239 10:97928763-97928785 ATGGCGAGAAAAAGGCACAGAGG + Intronic
1073028593 10:100506982-100507004 AAGGAGATACAAAGGCACCATGG + Intronic
1084449435 11:69227080-69227102 GTGGCAATAGAAGGGCACCCTGG + Intergenic
1085770175 11:79318230-79318252 GGGGGGATAAAAAGGCACCAAGG + Intronic
1091375763 12:23679-23701 GTGGGGACACAAAGGAACCAGGG + Intergenic
1091403109 12:192829-192851 GAGGCGATACAAAGGAAGGGAGG + Intronic
1091403119 12:192891-192913 GAGGCGATACAAAGGAAGGGAGG + Intronic
1096617838 12:52844380-52844402 GAGGCGATGCAGAGGAACCGTGG - Intronic
1097046188 12:56189295-56189317 GGGGCGGGACAAAGGGACCGCGG - Intronic
1097872339 12:64611245-64611267 GTGGGGGTCCAAGGGCACCGTGG + Intronic
1108441905 13:50462739-50462761 GTGGCTATAAAAGGGCACCACGG + Intronic
1108552186 13:51557593-51557615 GTAGTGATGCAAAGGCACTGTGG - Intergenic
1122923180 14:104888308-104888330 GTGGGGACCCAAAGGCACCAGGG - Intronic
1123666218 15:22611014-22611036 GTGGGGAAACAAAGGCCCGGAGG + Intergenic
1124320042 15:28705420-28705442 GTGGGGAAACAAAGGCCCGGAGG + Intronic
1124482469 15:30089997-30090019 GTGGGGAAACAAAGGCCCGGAGG - Intronic
1124488928 15:30142099-30142121 GTGGGGAAACAAAGGCCCGGAGG - Intronic
1124521106 15:30407212-30407234 GTGGGGAAACAAAGGCCCGGAGG + Intronic
1124537556 15:30559008-30559030 GTGGGGAAACAAAGGCCCGGAGG - Intronic
1124544012 15:30611063-30611085 GTGGGGAAACAAAGGCCCGGAGG - Intronic
1124563976 15:30798498-30798520 GTGGGGAAACAAAGGCCCAGAGG - Intergenic
1124754602 15:32396224-32396246 GTGGGGAAACAAAGGCCCGGAGG + Intronic
1124761100 15:32448579-32448601 GTGGGGAAACAAAGGCCCGGAGG + Intronic
1124777534 15:32600484-32600506 GTGGGGAAACAAAGGCCCGGAGG - Intronic
1127614141 15:60666713-60666735 CTACAGATACAAAGGCACCGAGG + Intronic
1131556912 15:93407664-93407686 GTGAGGATACAAAGGCATCCTGG + Intergenic
1132451167 15:101969322-101969344 GTGGGGACACAAAGGAACCAGGG - Intergenic
1133880102 16:9773594-9773616 GTGGGGAGACAAAGGCAGTGTGG - Intronic
1135559726 16:23466909-23466931 GGGGCGATTCTAAGGCACAGTGG + Exonic
1137574990 16:49593636-49593658 ATGGAGAAACAAAGGCACGGAGG - Intronic
1141840176 16:86568783-86568805 GTGGCGATAGAGAGGCGGCGTGG - Exonic
1148856340 17:50581064-50581086 GGGGCGAGACAGAGGCACGGAGG + Intronic
1160634097 19:63225-63247 GTGGGGACACAAAGGAACCAGGG + Intergenic
1162380252 19:10327681-10327703 GTGAGGATACCAAGGCACAGAGG - Intronic
1163813140 19:19447228-19447250 GTGGAGATGCAAAGGCCCTGAGG + Intronic
1167414225 19:49361878-49361900 GTGGCCAGACAAAGGGACGGTGG + Intronic
930177510 2:48315234-48315256 GGGGCGTTGCAAAGGCTCCGAGG - Intronic
934331559 2:92073958-92073980 GTGGGGACAAAAAGCCACCGTGG - Intergenic
936567382 2:113591803-113591825 GTGGGGACACAAAGGAACCAGGG - Intergenic
938386839 2:130872732-130872754 GAGGCGATACAAAGGAGCAGAGG + Intronic
938609088 2:132928183-132928205 GTGGAGATACTGAGGCACAGAGG - Intronic
1171505493 20:25629749-25629771 GTGGCCAAAGAAAGACACCGTGG - Intergenic
1172705724 20:36880788-36880810 GTGGCGAGACAAAGCTCCCGGGG + Intronic
1173579783 20:44138971-44138993 GAGGCGAGGCAAAGGCACAGCGG - Intronic
1179775522 21:43659510-43659532 ATGGCGTCACAAAGGCGCCGCGG - Intergenic
1181661359 22:24351707-24351729 GTGGCCATAAAAAGCCACTGTGG + Intronic
1184686668 22:46099411-46099433 GTGCAGACACAAAGGCCCCGGGG - Intronic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
950578710 3:13849105-13849127 GTGGCTATACAAGGGCAACCTGG + Intronic
953199304 3:40764239-40764261 GTGGCTCTACAAAGTCACCAGGG - Intergenic
955980113 3:64516309-64516331 GTGGAGAGACCAAGGCACCGTGG + Exonic
956070381 3:65443485-65443507 GTGGTGGTACAATGGCACTGGGG + Intronic
957832307 3:85538370-85538392 GTGGAGATACCAAGGCTCCTTGG + Intronic
963600800 3:147377553-147377575 GTGTGGATGCAAAGGCACTGGGG + Intergenic
968603663 4:1521471-1521493 GGCGGGATTCAAAGGCACCGCGG - Intergenic
971326954 4:25652489-25652511 GTGGTGAGACAAAGGCACCCAGG - Intergenic
986854920 5:11857327-11857349 GTGGCGATACAAAGGCACCGAGG + Intronic
990943616 5:61228520-61228542 GTGGCAAAACAAAAGCACGGTGG + Intergenic
1001364460 5:171122851-171122873 GTGGGGATACAAAGGCTGCTGGG - Intronic
1002789477 6:426864-426886 GTGCGGATGCAAAGGCACAGGGG + Intergenic
1003530381 6:6931895-6931917 GTGGCAAGACTAAGGCACAGAGG + Intergenic
1013316233 6:108945894-108945916 GTCGCCCTACAAAGGCACCAGGG - Intronic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1032657643 7:133948927-133948949 GTGGGGAAACAAAGGCACGCTGG - Intronic
1033281147 7:140007307-140007329 ATGGGGATACAAAGGAACCCAGG - Intronic
1048301924 8:133257922-133257944 GTGAGGATACAAAGGAACAGTGG + Intronic
1049165444 8:141122687-141122709 CTGGGGGTACAAAGGCACAGAGG - Intronic
1049885151 9:21730-21752 GTGGGGACACAAAGGAACCAGGG + Intergenic
1059341159 9:113598344-113598366 GAGGGGAAACAAAGGCACAGTGG - Intergenic
1186760969 X:12721217-12721239 GTGGCGATTCAGAAGCAACGAGG + Exonic
1190828773 X:54042702-54042724 GAGGCAATACACCGGCACCGAGG + Exonic
1191175144 X:57491425-57491447 TTGGTGATACAAAGGCAACCAGG + Intergenic
1197419354 X:126219084-126219106 GTGGCCCTAGAAAGGCACTGAGG - Intergenic
1198855408 X:141010457-141010479 GTGACGATACCAAGGCATCAGGG + Intergenic
1198907287 X:141576911-141576933 GTGACGATACCAAGGCATCAGGG - Intergenic
1198909504 X:141597490-141597512 GTGACGATACCAAGGCATCAGGG + Intronic
1198917583 X:141690655-141690677 GTGACGATACCAAGGCATCAGGG - Intronic
1199230476 X:145431768-145431790 GTGGCCATAGAAAGGCATAGGGG - Intergenic