ID: 986855018

View in Genome Browser
Species Human (GRCh38)
Location 5:11858333-11858355
Sequence CAGGCAAATATCCAGTTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986855014_986855018 29 Left 986855014 5:11858281-11858303 CCTTATAAATGATGTCAGTATAC 0: 1
1: 0
2: 0
3: 9
4: 170
Right 986855018 5:11858333-11858355 CAGGCAAATATCCAGTTGATAGG 0: 1
1: 0
2: 0
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986855018 Original CRISPR CAGGCAAATATCCAGTTGAT AGG Intronic
901397106 1:8989381-8989403 GAGGCAAAGATCCAGATGGTCGG + Intergenic
903951776 1:26999760-26999782 CAGGCAGATTTCAAGTTGAAGGG + Intronic
904456121 1:30649286-30649308 CAGGCAACTATCCTCATGATGGG - Intergenic
905251565 1:36652225-36652247 CAGGCAGAAATCCAGGTGAGAGG + Intergenic
906866705 1:49428884-49428906 AATACAAATATCCAGGTGATAGG - Intronic
907615794 1:55925352-55925374 CAAGCACAAATCCATTTGATGGG - Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
910019360 1:82568133-82568155 CTGGCAAATAAACAGTAGATTGG + Intergenic
910814144 1:91271712-91271734 CAGGGAAATATATAGTTGAGGGG + Intronic
911222795 1:95267247-95267269 AAGGCAAATGTCCAGGTGAGTGG - Intergenic
1070362204 10:75701565-75701587 CAGGAAAATAGCCAGTGGGTCGG + Intronic
1072573093 10:96675530-96675552 CTGGCAGATCTCCAGTTGCTGGG - Intronic
1078180500 11:9006183-9006205 CAGGCAGGGATCCAGGTGATGGG - Intergenic
1079250382 11:18782826-18782848 CAGGCAAATATATAGGAGATGGG + Intronic
1081385938 11:42473330-42473352 CTGGCAAATAGCCAGTAGTTGGG + Intergenic
1081480230 11:43479404-43479426 AAGTCAGATATTCAGTTGATGGG + Intronic
1084131017 11:67134421-67134443 AAGGGAAATACCCAGTAGATAGG + Intronic
1087139788 11:94754063-94754085 AAGGCAAATATCTACTTCATAGG + Intronic
1091611900 12:2017582-2017604 CTGGCAATTATCCAGGTAATTGG - Intronic
1091762936 12:3099157-3099179 CAGTCAAATATCCATATAATTGG - Intronic
1096588287 12:52639257-52639279 CAAGTAAATATCCAGTTGTTTGG - Intergenic
1099315599 12:81078648-81078670 CAGGTAAATCTCCCGTTTATGGG - Intronic
1102095093 12:110232887-110232909 CATGCTCATATCCAGCTGATGGG - Intergenic
1104808438 12:131604540-131604562 CAGCCAAATATCCTGTTGCCAGG + Intergenic
1105995278 13:25665213-25665235 CAGGTTAGTAACCAGTTGATAGG + Intronic
1106862038 13:33920305-33920327 AAAACAAATATCCTGTTGATTGG + Intronic
1108476625 13:50825614-50825636 CTGCCAAATATCCAGTTGTGTGG + Intronic
1109205891 13:59482330-59482352 AAGTCAAATATCCAGTAAATGGG - Intergenic
1109830451 13:67780068-67780090 GAGGGATATATCCAGTTTATTGG + Intergenic
1114629966 14:24152761-24152783 TCAGCAAATATCCAGTTTATAGG - Intronic
1117123120 14:52590928-52590950 AATGTAAATGTCCAGTTGATGGG - Intronic
1117785229 14:59276818-59276840 CATACAAATAGCGAGTTGATTGG + Intronic
1120115291 14:80609475-80609497 CACCCAAATACCCAGTGGATGGG - Intronic
1127465869 15:59244165-59244187 CAGACAAATATCTAGTTAATTGG + Intronic
1128242854 15:66113277-66113299 CAGGCACGTATGCAGCTGATGGG - Intronic
1128309874 15:66623297-66623319 CAGGCAAATAAACATTTGCTAGG - Intronic
1128673775 15:69594326-69594348 CAGTCAAATACCCAGTAGGTGGG - Intergenic
1132586955 16:709769-709791 CAGGAAAATATCCCATTGCTAGG - Intronic
1134217675 16:12328801-12328823 TAGGCAAAGATGGAGTTGATTGG + Intronic
1135498430 16:22972812-22972834 CAGGTACATGCCCAGTTGATTGG - Intergenic
1135988344 16:27201327-27201349 AAGGCAAATGACAAGTTGATGGG + Intergenic
1141280392 16:82625815-82625837 CATGCCAAGATCCAGTGGATGGG - Intergenic
1142847079 17:2686817-2686839 CAGGCTGAGATCCAGATGATAGG + Intergenic
1144076599 17:11725088-11725110 CAGGCAATAATGCAGGTGATGGG + Intronic
1148198242 17:45730260-45730282 CAGGGAAATTGCCAGTTGGTTGG - Intergenic
1151754791 17:76067915-76067937 AAGGCAAATGTCAAGTTGAAAGG + Intronic
1151916214 17:77120037-77120059 CAGTCTAATCTCCAGTCGATGGG - Intronic
1151992519 17:77585595-77585617 AATGCAAATATGCAATTGATGGG - Intergenic
1154209072 18:12363782-12363804 CAGGAAAAACTCCTGTTGATGGG - Exonic
1156713239 18:39974364-39974386 AAAGCAGATATTCAGTTGATTGG - Intergenic
1157051700 18:44173763-44173785 CAGGCAAAAATTCAGATGCTAGG + Intergenic
1166155826 19:40910402-40910424 CAGGGCAATATTCAGCTGATAGG - Intergenic
1166178976 19:41093893-41093915 CAGGACAATATTCAGCTGATAGG + Intronic
925778829 2:7360810-7360832 CCAGGAAATATGCAGTTGATTGG + Intergenic
931200458 2:60092657-60092679 CAGGTAGAAATCCAGTTAATTGG - Intergenic
932470647 2:71953004-71953026 CAGGCAAACATCCTCTTGTTTGG - Intergenic
933401433 2:81802202-81802224 CAGGAACATATATAGTTGATTGG - Intergenic
937286511 2:120757544-120757566 CAGGAAAAGATCCAGCTGAGAGG - Intronic
938703917 2:133903291-133903313 CAGGCATATATGGAGTTGCTGGG + Intergenic
943385049 2:187192444-187192466 CAGTCAAAGATACAGTTGTTAGG + Intergenic
944319984 2:198329123-198329145 CAGACAAAAAAACAGTTGATAGG - Intronic
944899898 2:204203533-204203555 CATACAAATATCCAGAGGATAGG - Intergenic
1170446186 20:16430453-16430475 CAGGGAATGATCCAGTGGATAGG - Intronic
1175641871 20:60636995-60637017 CAGGCAAGTATCTAGTTCTTGGG - Intergenic
1177111027 21:17028852-17028874 AAGGCAAATGTCCAATTGAGGGG + Intergenic
1177939184 21:27387501-27387523 CAGGAAAATATCAACTTGAGTGG + Intergenic
1184085148 22:42257580-42257602 CAGGCAACAATGCAGATGATGGG + Intronic
951159976 3:19407558-19407580 CAGGCAGATATCCAGGTATTTGG + Intronic
951445777 3:22778822-22778844 CAGTCAAATATCTATATGATTGG - Intergenic
952149473 3:30572406-30572428 CAGGACAATATCCTGTAGATTGG + Intergenic
952699081 3:36306413-36306435 CTGGGGAATATCCAGATGATAGG + Intergenic
957830525 3:85511212-85511234 CAGGAAAATATCCACTTGTAAGG + Intronic
960264247 3:115602328-115602350 CAGGCAAAGCTCCAGTTCCTGGG - Intergenic
960818663 3:121702797-121702819 CACACAAATATCAAGTTCATTGG + Intronic
960908717 3:122627200-122627222 CAGGAAAATAATCAGTTGACAGG - Intronic
966903519 3:184505256-184505278 CATGCAAAAATACAGTTGATGGG + Intronic
969571977 4:8014373-8014395 CAGAAAAAAATCCTGTTGATGGG - Intronic
974364959 4:60934657-60934679 AATGCAATTATCCAGGTGATTGG - Intergenic
974562642 4:63541528-63541550 CAGGCATATCTCCAGGTGTTTGG + Intergenic
975441394 4:74414686-74414708 CAGGCAAAGATCAAAGTGATGGG - Intergenic
977045101 4:92059847-92059869 CAGCCAAATGTACAGTTGGTTGG - Intergenic
977661030 4:99586374-99586396 CTGGTAATTATCCAGTTAATTGG - Intronic
978703113 4:111673211-111673233 CAGGCAAACATGCAAATGATGGG - Intergenic
981157969 4:141462366-141462388 CAGGCAAAGATACAGTTTCTTGG + Intergenic
983877636 4:172895742-172895764 AGGGCAAATATTCAGTTTATTGG - Intronic
986108934 5:4692073-4692095 AACGCAAATATACTGTTGATTGG + Intergenic
986160699 5:5225783-5225805 CAGGCAAATATGCATTTGCCTGG + Intronic
986855018 5:11858333-11858355 CAGGCAAATATCCAGTTGATAGG + Intronic
987733280 5:21805425-21805447 CAGGCAAATATCTGGTTGTTAGG + Intronic
988449931 5:31331465-31331487 CAGGCACAGATCAAGGTGATAGG + Intergenic
990374445 5:55155332-55155354 CACACAAATATCCAGTGGGTTGG + Intronic
991980286 5:72223394-72223416 CAAGCAATTATCCAGCTGACAGG + Intronic
993291156 5:86073101-86073123 AATGCAAATTTCCACTTGATTGG - Intergenic
993443714 5:87987045-87987067 CAGGCAAATATCCATTTCAAAGG - Intergenic
994389312 5:99171855-99171877 CAGGGAAATATCCAGCAGATGGG + Intergenic
1004550020 6:16637767-16637789 CAGGCAAATCGCAAGTTGTTGGG + Intronic
1009606663 6:65878510-65878532 CAGCCAAATATCAATTTGATTGG + Intergenic
1012723390 6:102778088-102778110 CTGCCAAATACACAGTTGATAGG - Intergenic
1015244246 6:131060001-131060023 AAGGCAAATAAACAGTTTATAGG - Intronic
1017148245 6:151254251-151254273 TGGGCAAAAACCCAGTTGATTGG + Intronic
1020941963 7:14551183-14551205 CATGCAAATATCTATTTGATAGG + Intronic
1026328819 7:69334572-69334594 TAGGCAAAAATCCTGTTAATGGG + Intergenic
1027991690 7:85371136-85371158 CAGGAAAAAATCATGTTGATAGG - Intergenic
1028076080 7:86517205-86517227 CAGGCAAATGTACATTTCATAGG - Intergenic
1033757565 7:144407566-144407588 CGGGCAAATGGCCAGATGATTGG + Intronic
1041605655 8:59779880-59779902 CTGGCAAATATCCAGGTTACTGG - Intergenic
1048448214 8:134508743-134508765 CAGGCAGAGTTCCAGTTGCTGGG - Intronic
1051815542 9:21101366-21101388 CATGTGAATATCCAGTTGCTAGG + Intergenic
1052163804 9:25296411-25296433 TCCACAAATATCCAGTTGATTGG - Intergenic
1059407490 9:114110412-114110434 GAGGAAAATATCCAGTTCATAGG - Intergenic
1059652213 9:116325431-116325453 CAGAGAAATGTCCAGTTAATTGG + Intronic
1186699125 X:12070457-12070479 TAGGCAACTATCCAATTGAGTGG + Intergenic
1189048854 X:37622094-37622116 CAGGGAAATGTCAAGTTGAAGGG - Intronic
1189082303 X:37987700-37987722 CAGGCAAATATCTACTTAAATGG - Intronic
1190726071 X:53191637-53191659 CAGGGAATTATGCAGTAGATGGG + Intronic
1190971530 X:55354006-55354028 CAGGCATAGATCTAGTTGAAAGG + Intergenic
1192218893 X:69183340-69183362 TAGGGAAAGATCCAGTTGAAAGG - Intergenic
1193325005 X:80169961-80169983 CAGGCCAATAACAAGTTGAATGG + Intergenic
1194456252 X:94107352-94107374 AAGTAAAATATCCATTTGATAGG + Intergenic
1196653184 X:118189664-118189686 CAGTAAAATAACCAGTTAATTGG - Intergenic
1199813332 X:151372383-151372405 CAGGCAAATGTCCAGGGGCTTGG - Intergenic
1200796303 Y:7344093-7344115 CAGGTAAATATATAGATGATAGG - Intergenic