ID: 986858250

View in Genome Browser
Species Human (GRCh38)
Location 5:11897450-11897472
Sequence CAGTATAAATAATTAGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 418}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986858250_986858252 -5 Left 986858250 5:11897450-11897472 CCAAAATCTAATTATTTATACTG 0: 1
1: 0
2: 2
3: 44
4: 418
Right 986858252 5:11897468-11897490 TACTGAGGCAGAAAAAGCTGTGG 0: 1
1: 0
2: 4
3: 32
4: 375
986858250_986858253 26 Left 986858250 5:11897450-11897472 CCAAAATCTAATTATTTATACTG 0: 1
1: 0
2: 2
3: 44
4: 418
Right 986858253 5:11897499-11897521 TAGCCTAGATCACTTATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986858250 Original CRISPR CAGTATAAATAATTAGATTT TGG (reversed) Intronic
900877478 1:5354061-5354083 CAGTAAATAAAATGAGATTTTGG - Intergenic
901283973 1:8061655-8061677 CAGTACAAATCAGTAGAATTTGG - Intergenic
901321152 1:8340695-8340717 CAGTGTAATTTATTAGATGTTGG + Intronic
901578850 1:10223872-10223894 CAGAAAAAATATTTAGGTTTAGG + Intronic
902434205 1:16386863-16386885 CAGTATAAACCATTAGATATTGG - Intronic
902971068 1:20050818-20050840 CAGAATTTATAATTTGATTTTGG - Intronic
904151213 1:28442913-28442935 CAATATAAATAAATACATGTTGG - Intronic
905716677 1:40157839-40157861 TAATACAAATAATTAGGTTTAGG - Intergenic
907090346 1:51718431-51718453 GAGTATAAATATTTTGATATAGG - Intronic
907678109 1:56537455-56537477 AAGCATAAATCATGAGATTTGGG - Intronic
908326056 1:63024767-63024789 ATGAATAATTAATTAGATTTGGG - Intergenic
909006672 1:70284213-70284235 TATTATAAATAAATAGCTTTTGG - Intronic
909097247 1:71303119-71303141 CAGAAAAGATTATTAGATTTTGG - Intergenic
909220946 1:72960780-72960802 CAAGATAAATAATGTGATTTTGG - Intergenic
909427349 1:75541547-75541569 GAGTAAAAATAATTTGCTTTAGG - Intronic
909506771 1:76400445-76400467 AACTATGAATATTTAGATTTTGG + Intronic
909988643 1:82194045-82194067 AGGTCTAAATAATTAGCTTTTGG + Intergenic
912202835 1:107477661-107477683 TAGTATAAATAATTACTTTTGGG - Intronic
912218639 1:107646397-107646419 CAATATAAATATTCATATTTGGG - Intronic
912451914 1:109772661-109772683 GATTATAAATATTTAGATTCTGG - Intronic
912823690 1:112886888-112886910 CATTTTAAAGAATTTGATTTAGG - Intergenic
913359275 1:117961754-117961776 CAGAATAAATAAGTGAATTTTGG + Exonic
915639540 1:157213333-157213355 CTGTATAAATAATGAAATTAAGG - Intergenic
916002373 1:160629332-160629354 AAATATTAATAATAAGATTTTGG - Intronic
916100372 1:161389013-161389035 CAGTATAAATGATTTGGGTTTGG + Intergenic
916385904 1:164269072-164269094 CTGTATAAATATTAAAATTTAGG - Intergenic
916540444 1:165748521-165748543 CAGTACATATCATTAAATTTGGG + Intronic
917337506 1:173940585-173940607 TATTATAAAAAATTAGCTTTAGG - Intronic
917780598 1:178392016-178392038 CATTGTAAATAATTTCATTTAGG - Intronic
918090009 1:181282019-181282041 AAGTATAAATTAATACATTTAGG - Intergenic
918701446 1:187613507-187613529 TAATATAAATAATTAGCTTCAGG + Intergenic
918824489 1:189305592-189305614 CAGTATAAAGAAGTGTATTTAGG + Intergenic
918981231 1:191561817-191561839 CAGGAAACATTATTAGATTTGGG - Intergenic
920405573 1:205707046-205707068 CTGTATAAATACTGAAATTTTGG - Intergenic
920981112 1:210836311-210836333 CAGCACAAATAATTAGAGGTAGG - Intronic
921606177 1:217158045-217158067 CTGTATAAAGTATGAGATTTAGG + Intergenic
921633490 1:217463760-217463782 AATTATACATAAATAGATTTGGG + Intronic
921943278 1:220865641-220865663 GAGTATAAATAAGTATATTAGGG - Intergenic
922488041 1:225991618-225991640 AGGGATAAATAATTAGGTTTGGG - Intronic
922488193 1:225993243-225993265 AAGGATAAATAATTAGGTTTGGG - Intronic
923173054 1:231434831-231434853 CAGTATCAATTAATAGATTTTGG + Intergenic
923592549 1:235332029-235332051 TAGCACTAATAATTAGATTTTGG + Intronic
923929281 1:238675033-238675055 CAGTAAACATCACTAGATTTTGG - Intergenic
924865584 1:247976118-247976140 CAGGATAAATAATTATTTTTGGG + Intronic
924866792 1:247991462-247991484 CAGGATAAATAATTATGTCTGGG + Intronic
1062939064 10:1408514-1408536 CTGTAAAACTAATTTGATTTTGG - Intronic
1063744082 10:8859613-8859635 CAGTAGAAAATATTATATTTAGG - Intergenic
1064422322 10:15201132-15201154 CAGTTGAAATAATTAAAGTTTGG + Intergenic
1064472099 10:15646332-15646354 CAATAAAAATAAGTACATTTAGG - Intronic
1065460958 10:25963812-25963834 GAGTATAAAGAAGTACATTTAGG - Intronic
1065767667 10:29046628-29046650 CAGTTTAAAAAATAATATTTGGG + Intergenic
1067153925 10:43759124-43759146 CACTTTAAAAAATTAGTTTTTGG + Intergenic
1068172536 10:53414548-53414570 CAGTTTAAATAATTTGCCTTAGG + Intergenic
1068405275 10:56580706-56580728 CAGTATATAGATTTAGATTTGGG - Intergenic
1069130447 10:64694926-64694948 GAGTTTAAGTAATCAGATTTGGG + Intergenic
1069405785 10:68096572-68096594 CAGTATTATTAATAATATTTGGG + Intergenic
1069504383 10:68984533-68984555 CAGTGTAATTTATTAGATTCTGG + Exonic
1069585088 10:69594344-69594366 TAAGATAAATAATTAGGTTTAGG + Intergenic
1069766911 10:70868998-70869020 CAGTAAAAATATTAAGATGTAGG - Intronic
1070195558 10:74153175-74153197 CAGGAAAAATATTTAGATTTAGG + Intronic
1072175556 10:92917258-92917280 CTATAAAAATAATTAGATTTGGG - Intronic
1072386352 10:94933629-94933651 AACAATAAATAATTAGAATTTGG + Intergenic
1072870403 10:99113640-99113662 CAGTATTAATAATTATGTTCTGG + Intronic
1073022466 10:100456899-100456921 CAATATATATAAATATATTTAGG - Intergenic
1073069836 10:100786475-100786497 CTGTGTAAAAAATTACATTTGGG - Intronic
1075910303 10:126118965-126118987 CAGGATAAATAATTAGATGTAGG - Intronic
1077943900 11:6873943-6873965 GAGTAAAAATAATCAAATTTGGG + Intergenic
1079782102 11:24620130-24620152 AATTACAGATAATTAGATTTTGG - Intronic
1079852185 11:25548889-25548911 CAATATAGGTAATTACATTTTGG - Intergenic
1080555365 11:33411202-33411224 CATTATAAATAAATAAAATTCGG - Intergenic
1080862669 11:36163490-36163512 CAGTGTAGGTAAATAGATTTCGG + Intronic
1082018813 11:47513823-47513845 AAGTATAATTAATTAAAGTTGGG - Intronic
1082192790 11:49267369-49267391 CAGAATAAAGAATTCAATTTAGG - Intergenic
1082913450 11:58403975-58403997 CAGTTTAGACCATTAGATTTAGG - Intergenic
1082922697 11:58512901-58512923 GAGTATAAATATATAGAATTTGG - Intergenic
1083239171 11:61373605-61373627 CATTATTTATAATTTGATTTTGG - Intergenic
1085005290 11:73082613-73082635 CATTATAAATAATGAGAGATTGG - Intronic
1086153242 11:83636824-83636846 CAGTATAAATCATTCATTTTGGG - Intronic
1086215049 11:84369092-84369114 CAGTATAAAAATGTAAATTTTGG - Intronic
1086647124 11:89236911-89236933 TGGTATTCATAATTAGATTTTGG - Intronic
1086830200 11:91552854-91552876 AAATATGAATAATTAGATTGAGG + Intergenic
1087558277 11:99750638-99750660 CAGTATATTTAGTTAGATTCTGG - Intronic
1087685674 11:101261239-101261261 CTGTAAAATTAATTAGATTTGGG - Intergenic
1087935858 11:104034449-104034471 CAGCCTAAATAATTATTTTTTGG - Intronic
1087963805 11:104387242-104387264 CATCATAAATCATTAGATTCAGG - Intergenic
1088025691 11:105178967-105178989 CATAATAAATAATTATTTTTAGG + Intergenic
1090025350 11:123162943-123162965 CAGCATAAATAACCATATTTAGG + Intronic
1091790026 12:3266799-3266821 CAGTATAAATAATCAGGCTGTGG + Intronic
1092107779 12:5935068-5935090 GACTATAAATAAATATATTTGGG - Intronic
1092493609 12:8969692-8969714 CACTTTAAAAAACTAGATTTTGG - Intronic
1093360397 12:18219238-18219260 CAGAGTCAATAATTAGATCTTGG - Intronic
1095355908 12:41274951-41274973 CAGTATAATTAGGTAGATTCAGG + Intronic
1096270316 12:50161013-50161035 CAGATTGAATAATTAGATTCTGG + Intronic
1097468809 12:59962211-59962233 CAATATAACTAATAAGATCTCGG + Intergenic
1098076083 12:66733139-66733161 GCATATAAATAATTAGATTCTGG - Intronic
1098625890 12:72666820-72666842 CAGTATAAATAATCAAATATTGG + Exonic
1098667991 12:73188418-73188440 TAGTATAAATAGTCAGGTTTGGG + Intergenic
1098713433 12:73798341-73798363 CAATAGCAATAATTAAATTTAGG + Intergenic
1098945404 12:76584044-76584066 CAGTAGAAAGAATGAGAGTTAGG - Intergenic
1099138049 12:78933472-78933494 TAGTAAAAATAATTTGATTTTGG + Intronic
1099216099 12:79855289-79855311 CTGTATTAATAATTATAATTTGG - Intronic
1099597688 12:84688757-84688779 AAATACAAATAATCAGATTTAGG + Intergenic
1100079690 12:90833246-90833268 CAATAAAAATAATTATATTGAGG + Intergenic
1100868130 12:98879738-98879760 TAGTACAGATAATTATATTTAGG + Intronic
1105419907 13:20242780-20242802 CAGTTTAAAGATTTAGATTTTGG + Intergenic
1107608556 13:42088337-42088359 CACTAGAAATAATTAGAATATGG + Intronic
1107612938 13:42134567-42134589 CAATATAAATAAATAGATATGGG + Intronic
1107642621 13:42459412-42459434 CAGTATAAATTATTGGTTATAGG - Intergenic
1108736719 13:53291779-53291801 CAGAATATAGAATTAGAGTTGGG - Intergenic
1108908498 13:55510529-55510551 CATTATAAATAATGCAATTTAGG - Intergenic
1109492261 13:63117336-63117358 CAAGATAAATAAATAGATTAAGG + Intergenic
1109566646 13:64125908-64125930 TAGTAAAAATAATTAAATTTAGG + Intergenic
1110138560 13:72099647-72099669 CAGATTAAATAATTAAATTTAGG + Intergenic
1111231633 13:85351828-85351850 CAGTCTGAATAATAACATTTTGG - Intergenic
1111243424 13:85505063-85505085 CAGAATAAACAATTATATTGGGG + Intergenic
1111265115 13:85800758-85800780 AAATATAAATAATTAGTGTTTGG + Intergenic
1111529717 13:89520963-89520985 CAATCTAGATAATGAGATTTGGG + Intergenic
1112624253 13:101084591-101084613 CAGCATAAATAATCACATGTTGG - Intronic
1113146911 13:107217748-107217770 CAGTAGAAATCAAGAGATTTGGG - Intronic
1113153546 13:107291170-107291192 CAGAATAAAGAAATATATTTGGG - Intronic
1113245972 13:108395779-108395801 TAGGATAAAAAATTAGTTTTTGG - Intergenic
1114053059 14:18939425-18939447 CATAATATATAATTTGATTTTGG - Intergenic
1114109499 14:19462501-19462523 CATAATATATAATTTGATTTTGG + Intergenic
1114759787 14:25300763-25300785 CACTATAAACTATTAGATCTAGG - Intergenic
1116220681 14:42083416-42083438 CAGTATAAAATGTTAGAATTAGG + Intergenic
1116221107 14:42088463-42088485 CAATATAAAAAGTTAGAGTTAGG + Intergenic
1116347571 14:43814540-43814562 GACTATAAAAAATTAGAATTTGG + Intergenic
1118048166 14:61995110-61995132 AAGTATAAATATTTAGCTCTGGG + Intergenic
1118526011 14:66644137-66644159 CTGTTTAATTATTTAGATTTGGG + Intronic
1119074609 14:71623649-71623671 AAGAATAAATACTTAGAATTTGG - Intronic
1119958510 14:78827338-78827360 CTGTACAAATAATTAATTTTTGG + Intronic
1120306690 14:82779912-82779934 CAGTCTAAAGATGTAGATTTAGG - Intergenic
1120411837 14:84167396-84167418 CATTATAAATTGTAAGATTTTGG - Intergenic
1121752202 14:96366442-96366464 CAGTATAAATGTTAAGGTTTAGG + Intronic
1124047855 15:26167066-26167088 CAGTATCAGTCATTACATTTGGG - Intergenic
1124352382 15:28966790-28966812 CAGTATAAATAAGGAAATGTGGG - Intronic
1125198309 15:37073950-37073972 CAGTCTAAATAATTATAATTTGG + Intronic
1126341369 15:47644799-47644821 CAGTATAAACTATTTGATGTGGG - Intronic
1126411981 15:48381369-48381391 CAGTACCAATAACTACATTTTGG - Intergenic
1127181730 15:56426795-56426817 CAGTAGAAATCATTACGTTTAGG - Intronic
1130741359 15:86603719-86603741 CAGTAGAAGTAATTAAACTTTGG - Intronic
1130832873 15:87619616-87619638 CAGTGAAAATTGTTAGATTTGGG - Intergenic
1130957396 15:88637406-88637428 CAGTACAAGAGATTAGATTTTGG + Intronic
1132307908 15:100830952-100830974 CAGTACAATTAAGTAGATTGGGG - Intergenic
1133633835 16:7647441-7647463 TAGTATAAATCCTTAGTTTTTGG - Intronic
1133892923 16:9898468-9898490 CATCTCAAATAATTAGATTTTGG - Intronic
1137876885 16:52005737-52005759 CAGCATTAATAGTTAGAGTTAGG - Intronic
1138225873 16:55293775-55293797 CAGTTTAAATAAATAGTATTAGG + Intergenic
1138406621 16:56800202-56800224 CAATATAATTAATGAAATTTTGG - Intronic
1138870966 16:60885235-60885257 GAGTATAAATACTTATAATTTGG + Intergenic
1139339175 16:66256700-66256722 CTTTATTAATAATTGGATTTAGG + Intergenic
1139397985 16:66655815-66655837 CAAAATAAATAATTATAGTTTGG + Intronic
1139454849 16:67065726-67065748 GAGTTGAAATAAGTAGATTTTGG + Intronic
1142568755 17:858317-858339 CATTTTAAAAATTTAGATTTAGG - Intronic
1144574538 17:16420615-16420637 CAATACAGATATTTAGATTTTGG - Intronic
1150996476 17:70323533-70323555 CAGCCTAAATAAGTTGATTTGGG - Intergenic
1151121208 17:71795604-71795626 AATTATAAATAATTAGTCTTGGG - Intergenic
1151202237 17:72477012-72477034 AAGTTTAAATGATTAAATTTTGG - Intergenic
1153091321 18:1347298-1347320 CAGTATAGATAATCAGTTCTTGG + Intergenic
1155046368 18:22106901-22106923 AAGTATACTTCATTAGATTTGGG - Intergenic
1155332258 18:24730323-24730345 CAGTATAAATAAGTAGCATACGG - Intergenic
1155340976 18:24813837-24813859 CAGCAGAAATAATTATGTTTCGG - Intergenic
1155542498 18:26883086-26883108 TAATATAAATAATAAGGTTTTGG + Intergenic
1156211976 18:34954166-34954188 CAGTAGCACTAATTATATTTTGG - Intergenic
1156942941 18:42792809-42792831 TACTAAAAATAAATAGATTTGGG - Intronic
1157193059 18:45597398-45597420 CAGTAAATATTATTTGATTTTGG + Intronic
1157269459 18:46260331-46260353 AACTATTAATAATTAGAGTTAGG + Intronic
1157392276 18:47312738-47312760 CACTGGAAATAGTTAGATTTGGG + Intergenic
1159675475 18:71279144-71279166 CATTAAAAATAATAAGATTTGGG + Intergenic
1160082533 18:75742651-75742673 CAGTATAAATATACAGTTTTTGG - Intergenic
1164791248 19:30984156-30984178 CAGTATATAAATTTAAATTTGGG + Intergenic
1165666564 19:37635157-37635179 CAGTATGAATACTTTGATGTTGG + Exonic
1168226753 19:55000823-55000845 CAGTATCAATAATCAGTTGTGGG - Exonic
924970198 2:119144-119166 CAGTATAAATAATATAATTTCGG + Intergenic
925753218 2:7108610-7108632 CTGTATAAATATCTGGATTTGGG - Intergenic
925883978 2:8378389-8378411 CAGTGAAAATAATTTGTTTTGGG + Intergenic
925941017 2:8819007-8819029 CAGTATTAATAATCTGTTTTTGG + Intronic
926659759 2:15451604-15451626 CAGTAGAACAAATTTGATTTAGG - Intronic
927237436 2:20887095-20887117 CAGTAGAAAGAAATAGATTCTGG + Intergenic
928055317 2:28047249-28047271 AAGCATAATTAATTTGATTTTGG + Intronic
928495895 2:31831483-31831505 AAGTATCAAAAATTATATTTAGG - Intergenic
930027220 2:47036431-47036453 AAGGAAAAATAATTAGTTTTAGG + Intronic
930511375 2:52349604-52349626 CTGTAAAAATAGTAAGATTTGGG - Intergenic
930939029 2:56991497-56991519 TAGTATAAGTTAATAGATTTTGG + Intergenic
931433060 2:62224955-62224977 GAGTATAAATAATTTAATTAGGG + Intergenic
931725922 2:65110543-65110565 CAGTATAAATGATTATAAATGGG + Intronic
933451472 2:82458576-82458598 CAGAAGAAAGAATTAGATTGAGG + Intergenic
935877909 2:107531878-107531900 CAGTGTAAGTAACTAGATTGGGG + Intergenic
936411902 2:112266655-112266677 CTTTTCAAATAATTAGATTTTGG - Intergenic
936625843 2:114148656-114148678 CATGTTAAATAATTAGATATGGG + Intergenic
937766505 2:125667045-125667067 AAGTCTAAATAATTAATTTTTGG + Intergenic
937923068 2:127146063-127146085 GAATATGAATAATTAGTTTTGGG - Intergenic
938004837 2:127780561-127780583 CTGTTTAAATAAGTAGGTTTTGG + Intronic
938471051 2:131561986-131562008 CATAATATATAATTTGATTTTGG - Intergenic
939069796 2:137525446-137525468 AAGTATAAGTAACTAGCTTTTGG - Intronic
939337145 2:140844366-140844388 AAGCATAAAAAATTAGAATTAGG - Intronic
939530797 2:143358871-143358893 TATTATAAATGATTAGAATTTGG - Intronic
940296064 2:152125873-152125895 GAGTATAAATCTTTTGATTTAGG - Intronic
941447561 2:165621252-165621274 CAGAACAAATAATAATATTTTGG - Intronic
942400851 2:175601392-175601414 CAATGGAAATAATTACATTTGGG - Intergenic
942450173 2:176104285-176104307 GAGCATAAATAATTAAAGTTTGG + Intronic
942532994 2:176932829-176932851 CAAAATAAATAATTTTATTTTGG - Intergenic
943370894 2:187014380-187014402 AAGCATAAATACTTAAATTTAGG + Intergenic
943582641 2:189702688-189702710 AATTTTAAATAAATAGATTTGGG + Intronic
943834537 2:192502129-192502151 AAGGACAAATAACTAGATTTGGG - Intergenic
945131273 2:206575425-206575447 CAGTATGGGTATTTAGATTTTGG + Intronic
946627057 2:221624343-221624365 CCGTATAAATATTCAAATTTAGG - Intergenic
946680294 2:222207306-222207328 GCATCTAAATAATTAGATTTTGG + Intronic
947114845 2:226758513-226758535 AAGTCTAAATATTTATATTTAGG - Intronic
947114847 2:226758516-226758538 AAATATAAATATTTAGACTTGGG + Intronic
948611641 2:239171628-239171650 CAGTATAAAACAACAGATTTAGG + Intronic
1169614882 20:7430237-7430259 CTGTATAATTGATAAGATTTAGG + Intergenic
1169742191 20:8907047-8907069 GAGAATAAAAAATTATATTTTGG + Intronic
1170371846 20:15657690-15657712 CAGTCTTAATAATTAGCTTCAGG + Intronic
1171375090 20:24687212-24687234 CATTATAAAGAAATAGATGTTGG - Intergenic
1172373437 20:34415763-34415785 CACTATAAATACTGAGGTTTAGG - Intronic
1173053938 20:39593004-39593026 CAGTACAATTAATTATATCTTGG - Intergenic
1174176242 20:48646841-48646863 GAGTTTAAATAATTAGCTTGAGG - Intronic
1174226118 20:49001716-49001738 TAGTAAGAATAATTAGCTTTGGG - Intronic
1175028035 20:55923698-55923720 CAAAAGAAATAATGAGATTTTGG - Intergenic
1175591735 20:60198642-60198664 CTGCATAAATAATTAAATTAAGG - Intergenic
1176986159 21:15439353-15439375 CTTTACAAATAATTAGATTTAGG - Intergenic
1177274858 21:18896818-18896840 CAGTAGAAATAATTGTATTTCGG + Intergenic
1177461725 21:21421001-21421023 TTTTATAAATAATTAGATATAGG + Intronic
1177572944 21:22911433-22911455 CAATAAAAATAATTATATTTCGG - Intergenic
1177677743 21:24324159-24324181 CAGGATACCTAATGAGATTTAGG - Intergenic
1177880830 21:26692390-26692412 CAATATAAAGAATTTGATATAGG + Intergenic
1178612029 21:34091480-34091502 CATGATAACTAATTACATTTTGG + Intronic
1178779088 21:35582520-35582542 CAGTATACATTTTTAGATGTTGG - Intronic
1178816031 21:35930333-35930355 GAGTATATATATTTAGATGTGGG - Intronic
1179088641 21:38243082-38243104 CATTATAATTACTGAGATTTGGG + Intronic
1179530698 21:42016971-42016993 AAATATAAAAAAATAGATTTTGG - Intergenic
1180471532 22:15661800-15661822 CATAATATATAATTTGATTTTGG - Intergenic
1180591934 22:16946879-16946901 TAGTATAAATAAATATATGTTGG - Intergenic
1182403499 22:30102968-30102990 AAGTATAAAAAGGTAGATTTCGG + Intronic
1182984268 22:34701705-34701727 CAGTATAAATAAAAAGATGCAGG + Intergenic
1185405897 22:50650443-50650465 CAGAATTTATAATTTGATTTTGG - Intergenic
949148049 3:727656-727678 CAGTAATAATAATTAGCTTTTGG + Intergenic
949276868 3:2294187-2294209 TAGTGTAAATCATAAGATTTAGG + Intronic
949499069 3:4661556-4661578 CAGTATAAGTAAATAGACATGGG + Intronic
949757525 3:7430219-7430241 TTGAATAAATAAGTAGATTTTGG + Intronic
950911434 3:16598394-16598416 CATTATGAATAATGGGATTTGGG - Intronic
951394005 3:22142283-22142305 ATGTATAATAAATTAGATTTTGG + Intronic
951452757 3:22857753-22857775 CAAAATAAATAATAAGACTTTGG - Intergenic
951704242 3:25527742-25527764 CAGGAGAAATAATCACATTTAGG - Intronic
952130974 3:30362649-30362671 CAGAATAAATAAATAAATATGGG + Intergenic
952848720 3:37710672-37710694 CAGTATGAATAATTAGCCCTAGG + Intronic
953258907 3:41318384-41318406 AAAAATATATAATTAGATTTGGG + Intronic
957271209 3:78032367-78032389 TTGACTAAATAATTAGATTTTGG + Intergenic
957678100 3:83396109-83396131 CAGCATTAATACTGAGATTTAGG - Intergenic
958146911 3:89637060-89637082 AAGAAAAAAAAATTAGATTTGGG - Intergenic
959565854 3:107832476-107832498 CAGAATAAGCAAATAGATTTGGG + Intergenic
959603395 3:108215091-108215113 TAGGATCACTAATTAGATTTTGG - Intronic
960337058 3:116430613-116430635 AAGTATCTATAATTATATTTAGG - Intronic
960714792 3:120564265-120564287 CAGTGAAAATAATTGGATTTGGG + Intergenic
961131803 3:124475366-124475388 CAGTTTATATAATTAGAATCTGG - Intronic
961586532 3:127932345-127932367 CTGTATATATAATTGGAATTCGG + Intronic
962427542 3:135285133-135285155 CAGAATTTATAATTTGATTTTGG + Intergenic
962604024 3:137016768-137016790 CAGAATAAATCATAAAATTTGGG + Intergenic
963497117 3:146079424-146079446 CACTATATTTAATGAGATTTAGG + Intronic
963927495 3:150966382-150966404 CAGTTTAAGAAGTTAGATTTAGG + Intronic
965000249 3:162943864-162943886 CAGAAGAAAGAATTAGACTTCGG - Intergenic
965269959 3:166602350-166602372 CAGAATAAATCATTAGAAGTTGG + Intergenic
965651825 3:170942334-170942356 CAGTATAAATTATTTTGTTTGGG - Intergenic
965841670 3:172912380-172912402 CAGAAAAAATAGTTAGATATTGG - Intronic
966125150 3:176567543-176567565 CATTGTAAACAATTAAATTTTGG + Intergenic
966695156 3:182782256-182782278 CAGGATAATTTAATAGATTTGGG + Intergenic
966905102 3:184517020-184517042 CACCATAAAAAGTTAGATTTCGG + Intronic
967498810 3:190173857-190173879 CTGTGGAAATAATTAGATTTTGG + Intergenic
967758939 3:193202384-193202406 CAGAATCAATATTTAAATTTTGG + Intergenic
968015318 3:195326574-195326596 CACTATTCATAATTACATTTAGG - Intronic
970417183 4:15870700-15870722 CAGTAGTAAAAATTAGCTTTAGG + Intergenic
971012788 4:22457260-22457282 GTTTATAAATAATTTGATTTAGG - Intronic
971600454 4:28585034-28585056 AAGTATAAATAATCAGAATAAGG + Intergenic
972228357 4:37041431-37041453 CAGAATAAAAAATTAGAGTAAGG + Intergenic
972968465 4:44542455-44542477 CAGCATCAATACTTAGATTTTGG + Intergenic
972983734 4:44738220-44738242 AAGAATATATAATGAGATTTAGG + Intergenic
973114609 4:46439762-46439784 CATTAAAAATAATTAATTTTTGG - Intronic
973119609 4:46504720-46504742 CAGTATAAATGATCACATTATGG - Intergenic
974230472 4:59107084-59107106 GAGTAGAAATATTTTGATTTGGG + Intergenic
974972452 4:68846476-68846498 AAATAGAAATAATTATATTTTGG - Intergenic
975051525 4:69870962-69870984 CATAATTAATAATTTGATTTTGG - Intergenic
977175352 4:93813715-93813737 CAGTACAAATTATTTTATTTCGG - Intergenic
977211896 4:94227756-94227778 AAGTAGGTATAATTAGATTTGGG + Intronic
977831726 4:101602395-101602417 CAGTATAAATAATTTTAATATGG - Intronic
978748448 4:112221511-112221533 CAGTAAAAAAAATTAAATTGGGG - Intergenic
978877686 4:113661378-113661400 AAGAATAAATAAATAAATTTAGG - Intronic
978940156 4:114426871-114426893 CTGGATAAATAATTAAATTAAGG - Intergenic
978971775 4:114816290-114816312 CAGCATAAATAATTTGTCTTAGG - Intergenic
979008171 4:115331454-115331476 TCGTATAAATAAGTAGATCTTGG + Intergenic
979009387 4:115347925-115347947 AAGTAGAAATAATAAGATTTTGG + Intergenic
979094465 4:116529014-116529036 CAGAGGAGATAATTAGATTTAGG + Intergenic
979438970 4:120728307-120728329 CAGTATAAATAAATAGCATTTGG + Intronic
979525368 4:121710352-121710374 CAGTAAAAATAATTACAGTAAGG + Intergenic
979845320 4:125502337-125502359 CAGTATTTATAACTAGAATTGGG - Intergenic
979956820 4:126963717-126963739 AAGTATAAATTATTGCATTTGGG - Intergenic
980229859 4:130035030-130035052 CTGTATAAATACTTAGATATGGG - Intergenic
980506006 4:133722588-133722610 CAGTATATATAATTATATCTTGG - Intergenic
980550920 4:134334228-134334250 CAGTAAAAAAATTTACATTTGGG - Intergenic
980559030 4:134447685-134447707 AGTTATCAATAATTAGATTTTGG + Intergenic
980922905 4:139104725-139104747 AATTAAAAATAATGAGATTTAGG + Intronic
982897391 4:160950067-160950089 CAGTATATTAAATTAGATTGTGG + Intergenic
982991334 4:162279542-162279564 CTGTATATATAATTATTTTTAGG - Intergenic
982999261 4:162391286-162391308 CAGTATAAGTAATTAAATTTTGG - Intergenic
983764850 4:171465847-171465869 CAGTATAAGTACTTAAAATTTGG + Intergenic
983837364 4:172407241-172407263 CAGGATCAATAATCTGATTTAGG + Intronic
984000780 4:174240768-174240790 CACTATAAACACTTAGATTATGG + Intronic
984176267 4:176421667-176421689 CAGTAATAATTATTACATTTAGG - Intergenic
984421308 4:179525676-179525698 CAGTGGAAATAATTGGATTATGG - Intergenic
985244014 4:187961146-187961168 CAAGATAAATATTTATATTTTGG - Intergenic
985317698 4:188675609-188675631 CCGTATAAATAATGAAATTAAGG + Intergenic
986858250 5:11897450-11897472 CAGTATAAATAATTAGATTTTGG - Intronic
987000267 5:13652943-13652965 TAGTTTAAATAAATTGATTTTGG - Intergenic
987460935 5:18209462-18209484 AAGTATGAATAATTTTATTTTGG + Intergenic
987900572 5:24005890-24005912 CAATACAAAGAATTAGAATTTGG - Intronic
988407809 5:30846604-30846626 CATTATTATTTATTAGATTTTGG - Intergenic
988630758 5:32928834-32928856 CTGTATAAATAATCAGGGTTTGG - Intergenic
988984979 5:36608934-36608956 CATTGTATATAATTACATTTTGG - Intronic
992711607 5:79463728-79463750 CAGTATACACAATTTGATTTTGG + Intronic
992745225 5:79813091-79813113 CAGAATAAATAAATATATTGTGG - Intergenic
992779224 5:80113077-80113099 CAATATAAATAATTTTATTCTGG + Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993301194 5:86213004-86213026 CACTATCAATATTGAGATTTTGG - Intergenic
993626943 5:90237109-90237131 CATTATAAGTGATTAGATTTAGG + Intergenic
993739898 5:91525689-91525711 CAGTATGAATGCTTAGATTGTGG + Intergenic
993972759 5:94440600-94440622 CATATTAAATAATTAGATTACGG - Intronic
994059725 5:95460974-95460996 CAGTATAAAAAAGTTTATTTGGG - Intergenic
994066111 5:95544536-95544558 CAAAATAAATAATTTTATTTTGG - Intronic
994587651 5:101730315-101730337 GAGTAGAAATGAGTAGATTTGGG + Intergenic
994846219 5:104991959-104991981 CAGAATACACAATTACATTTAGG + Intergenic
994867524 5:105295588-105295610 CAATGTAAATAATTTAATTTAGG + Intergenic
995559176 5:113362758-113362780 AAATATATATATTTAGATTTTGG + Intronic
995871338 5:116746691-116746713 TAGTATGCATAATTATATTTGGG - Intergenic
996481141 5:123975884-123975906 GATTATAATTCATTAGATTTGGG + Intergenic
996550528 5:124725513-124725535 CAGCAAAAATAATTAGAATGGGG - Intronic
996611571 5:125386798-125386820 TACAATAGATAATTAGATTTAGG - Intergenic
997911658 5:137880017-137880039 GAGTACAAATAATTTGCTTTGGG - Intronic
1000530378 5:162411820-162411842 CAGTACAAATAATAAGATCAAGG - Intergenic
1000584123 5:163075333-163075355 CAGGAAAAATCATTTGATTTTGG + Intergenic
1001056880 5:168457044-168457066 CGGTATAAATAATAAAATATGGG - Intronic
1001105036 5:168845635-168845657 CATTATATATATTTTGATTTAGG - Intronic
1001637844 5:173225282-173225304 CAGTGTAAATAAATAGATGATGG - Intergenic
1002498246 5:179630609-179630631 CAGTATAAATGCATACATTTCGG + Intronic
1003557078 6:7149663-7149685 CAGCAGAAATTATTAGGTTTTGG + Intronic
1003792437 6:9561871-9561893 CAGTACAAATAATTAACTTTAGG - Intergenic
1003793432 6:9573590-9573612 CATTATAAATATTTAAATTGGGG + Intergenic
1003912961 6:10759214-10759236 CATTAAAAAGAATTAGATCTTGG - Intronic
1008420814 6:51297355-51297377 CAGTATTAATATTTACTTTTAGG - Intergenic
1009426271 6:63517040-63517062 TAGTATTATTAATTAGAATTAGG - Intergenic
1009506712 6:64492275-64492297 CAGCAGAAATCATTAGAATTTGG - Intronic
1010184125 6:73123191-73123213 CAATATAAATAAATAAATATAGG + Intronic
1010331580 6:74629212-74629234 CTGGATAAATAATGAAATTTAGG + Intergenic
1010464658 6:76153043-76153065 CACTATAAAAATTTAGATCTAGG + Intergenic
1010714705 6:79214930-79214952 CAATGTAAATAATTAAATATAGG + Intronic
1011097799 6:83685436-83685458 CATTAAAAATAATTAAAGTTAGG + Intronic
1011951180 6:92966733-92966755 CAGTATAAATAATTTGCCTTAGG - Intergenic
1011990375 6:93508294-93508316 CATGATAAATTATTACATTTTGG - Intergenic
1012543097 6:100385111-100385133 CAATATAAATAATTATAAATGGG + Exonic
1013312821 6:108913324-108913346 CTGTGTTAAAAATTAGATTTAGG + Intronic
1013879031 6:114871341-114871363 CATGATAAAAAATTAAATTTTGG - Intergenic
1014116187 6:117670794-117670816 AGGTAAAAATAATTAGATTATGG + Intergenic
1014385091 6:120790853-120790875 CATTAAATATAATTAAATTTAGG - Intergenic
1014630822 6:123788092-123788114 CAGTTTAAATATTAAGATATAGG - Intergenic
1015701705 6:136042372-136042394 TTGAATAAATAATTAGATTTTGG + Intronic
1015803685 6:137087302-137087324 AAGTATAAATATTTCTATTTTGG - Intergenic
1016363875 6:143295099-143295121 CAGCATAAACAACTAGTTTTGGG - Intronic
1017308272 6:152946296-152946318 TATTATAAAAAATTATATTTTGG + Intergenic
1018166606 6:161103806-161103828 CAGTATAAATAATACGATACTGG + Intronic
1018622963 6:165749685-165749707 AAGTTTAAAAAATTAGATTGGGG - Intronic
1019855772 7:3605658-3605680 CTGATTACATAATTAGATTTGGG + Intronic
1020034085 7:4953392-4953414 CAGTGTAAAGAATTGGAATTGGG - Intronic
1020526673 7:9270114-9270136 GAGGATAAATAATTATATTTTGG + Intergenic
1021472004 7:21013714-21013736 CAGAATAAAACATAAGATTTGGG - Intergenic
1022712815 7:32867555-32867577 CAGTACAATTAATAAGATCTAGG + Intergenic
1022976299 7:35559614-35559636 AAGTTTAAATAATTTGCTTTGGG - Intergenic
1027003119 7:74668364-74668386 AAGTATATATAATTATATTATGG + Intronic
1027740814 7:82002087-82002109 CATTAAAAATATTTATATTTGGG - Intronic
1027895870 7:84044212-84044234 CAATATAAATTATTAGACCTAGG - Intronic
1027972468 7:85103020-85103042 CAAATTAAATAATTAGATTTAGG + Intronic
1028023867 7:85811581-85811603 CACAATAAATAATGAGATTTTGG + Intergenic
1028132490 7:87192602-87192624 CTATATAAAAAATTTGATTTAGG - Intronic
1028328186 7:89553134-89553156 AAGTTTAAATAATTAATTTTAGG - Intergenic
1028518372 7:91702115-91702137 CTGTGTAAATAATGAAATTTAGG + Intronic
1028604126 7:92636615-92636637 AGGAATAAATAATTACATTTTGG + Intronic
1028911582 7:96213718-96213740 ATGTAAAAATAATTAGAATTAGG + Intronic
1030594662 7:111523158-111523180 AAGGATATATAATTATATTTAGG + Intronic
1031729514 7:125280979-125281001 TAGTATAAATTATTTTATTTTGG - Intergenic
1033880728 7:145880255-145880277 CAATAAAAATAATAAAATTTGGG + Intergenic
1034222135 7:149455021-149455043 CAGGAGAAATAATTTGATTTTGG + Intronic
1034686383 7:152974912-152974934 CAGCAAAAACAGTTAGATTTAGG + Intergenic
1036939225 8:13035321-13035343 CCGTATCCACAATTAGATTTGGG - Intergenic
1036955042 8:13178839-13178861 GAGTATAAATAAGTACAGTTTGG + Intronic
1038098626 8:24345609-24345631 GAGTATAAAGAATCAAATTTAGG - Intronic
1038365722 8:26931554-26931576 CAGTCTGATTAATTACATTTAGG - Intergenic
1038566649 8:28624699-28624721 GACTATTAATAACTAGATTTTGG - Intronic
1038817673 8:30922387-30922409 CTGAATAAATATTTTGATTTAGG + Intergenic
1040062997 8:43120546-43120568 CTGTATAAATATATACATTTTGG + Intronic
1041317175 8:56575892-56575914 CAGTATGAATAACTCCATTTTGG - Intergenic
1041459880 8:58099418-58099440 CAGTTTAAATAATTAAATGCAGG - Intronic
1041571080 8:59337470-59337492 CATTATAAAAATTTTGATTTTGG + Intergenic
1042936050 8:74059490-74059512 CAGAATAGATAATTAGATCTGGG + Intergenic
1043109704 8:76165224-76165246 CTCTATCCATAATTAGATTTAGG - Intergenic
1043329516 8:79097752-79097774 CATTATAAATAATTTAATTTTGG + Intergenic
1043359028 8:79448796-79448818 AAGAATAAATAATTACATTTTGG + Intergenic
1043824779 8:84912941-84912963 CAGTATAAATGATTTAGTTTTGG + Intronic
1043966532 8:86483911-86483933 TACTATAAATAATTAACTTTAGG + Intronic
1044034615 8:87285435-87285457 TTGTATAAATAATGAGATTGAGG + Intronic
1044391127 8:91652753-91652775 CAGAATAAATATTTTGGTTTGGG - Intergenic
1045249781 8:100473803-100473825 TAGTATAAATAATTAAAACTAGG + Intergenic
1046086838 8:109447539-109447561 TAGAACAAATAATTAGATTCTGG - Intronic
1046493845 8:114987466-114987488 AATTATAAATAATAAAATTTGGG + Intergenic
1047071558 8:121349802-121349824 AACTATAAATAATGAGTTTTAGG - Intergenic
1047473937 8:125207056-125207078 AAGTATGAATAATTTTATTTAGG - Intronic
1048291850 8:133187180-133187202 CAGTATAGATAAGAAGATGTGGG + Intergenic
1048715879 8:137268965-137268987 CAGTGTAAATAATGAAATTAAGG + Intergenic
1050522518 9:6516132-6516154 CAGTTTAAAAAATTATGTTTGGG - Intergenic
1050676184 9:8056564-8056586 CATTGTAAACAACTAGATTTGGG - Intergenic
1052050644 9:23844610-23844632 CAGTAAAAATAATTAACTATGGG - Intergenic
1052547603 9:29900373-29900395 CAGAAGAAATAATTAGACTGAGG + Intergenic
1053477097 9:38390431-38390453 GAGTCTAAATTATTAGATGTAGG - Intergenic
1054772996 9:69100504-69100526 TAATATAAATAATTATATCTTGG + Intergenic
1056141911 9:83690032-83690054 AAGTATAAATCAGTACATTTTGG + Intronic
1056244568 9:84681406-84681428 AAATATTAAAAATTAGATTTAGG - Intronic
1056674262 9:88660164-88660186 CAGTAAAATTTATTAAATTTTGG - Intergenic
1056885228 9:90435808-90435830 CAAGATAAATAATCAGATTTAGG - Intergenic
1056945249 9:90989537-90989559 CACTTTAAAAAAATAGATTTAGG + Intergenic
1057664730 9:97036367-97036389 CATTATAAATTATTAGCCTTTGG - Intronic
1057923877 9:99125077-99125099 CAGTAGAAAAAAATAGCTTTAGG + Intronic
1058252023 9:102710971-102710993 AAGAATAAATAATTAGAGCTGGG + Intergenic
1058703043 9:107616472-107616494 CAGTAGAAATATGTAGATTGAGG + Intergenic
1058786905 9:108397282-108397304 CAGGATTGAAAATTAGATTTGGG - Intergenic
1059538389 9:115105926-115105948 CAGAATAATCAAGTAGATTTGGG - Intronic
1059828336 9:118059677-118059699 CAGGGAAAATAATTAGCTTTTGG + Intergenic
1060039566 9:120288122-120288144 CAGCATATATAAATAGAATTTGG + Intergenic
1060309317 9:122445201-122445223 TAGTATAAATACTAACATTTGGG - Intergenic
1186057156 X:5661936-5661958 CAATATTTATATTTAGATTTAGG - Intergenic
1186129356 X:6449513-6449535 CACTAAAAATAATTACATTTGGG - Intergenic
1186216097 X:7302832-7302854 CAGTCGAAATAATTAAATATAGG - Intronic
1186378171 X:9030894-9030916 GAGTATAAAAATTTAGGTTTAGG + Intronic
1186643031 X:11476838-11476860 TAGTTTTAATAATTACATTTAGG - Intronic
1186823812 X:13317604-13317626 AAGTAGACATGATTAGATTTTGG + Intergenic
1186975022 X:14892987-14893009 CTTTATAAATAATTATATTCTGG - Intronic
1187066226 X:15840910-15840932 ATGAATACATAATTAGATTTGGG - Intronic
1187735418 X:22298356-22298378 TTGAATAAATAATTAGCTTTGGG + Intergenic
1189022617 X:37356916-37356938 TAATATAAACAATTAGCTTTAGG - Intronic
1189146894 X:38664786-38664808 CAGTAAAAACAACTAGAGTTTGG - Intronic
1190894660 X:54605241-54605263 AAGTATAAAAAATTAGAATTAGG - Intergenic
1192366067 X:70474394-70474416 AAGTATAAAGAAATAGATTGAGG + Intronic
1193648661 X:84101864-84101886 CAGTGTAAATATTTATATTAGGG + Intronic
1193659728 X:84242906-84242928 AATTAAAAATAATGAGATTTTGG - Intergenic
1193803580 X:85967239-85967261 CAGTATAAAGTTTTAAATTTGGG - Intronic
1194307147 X:92260927-92260949 CACTATATATAATTTAATTTGGG + Intronic
1195061872 X:101204089-101204111 TAGCATAAATAAGTATATTTTGG - Intergenic
1195305315 X:103576390-103576412 GAATATAAATGATTAAATTTTGG - Intronic
1196175502 X:112635182-112635204 TAGTTTAAATAATGGGATTTGGG - Intronic
1197228602 X:123978810-123978832 CAATATTAATATTTGGATTTTGG + Intronic
1197342595 X:125290753-125290775 CAGAAAATATAATTAGAATTTGG + Intergenic
1199655141 X:149986985-149987007 CAGTATAAGGAATAAGATATTGG - Intergenic
1201387364 Y:13456189-13456211 TAGTATAAATATTTAAATCTAGG - Intronic
1201799615 Y:17940865-17940887 CTGTATAATTAATACGATTTGGG + Intergenic
1201801938 Y:17965091-17965113 CTGTATAATTAATACGATTTGGG - Intergenic
1202361927 Y:24119744-24119766 CTGTATAATTAATACGATTTGGG - Intergenic
1202363146 Y:24133352-24133374 CTGTATAATTAATACGATTTGGG + Intergenic
1202507633 Y:25536765-25536787 CTGTATAATTAATACGATTTGGG - Intergenic
1202508851 Y:25550369-25550391 CTGTATAATTAATACGATTTGGG + Intergenic