ID: 986860914

View in Genome Browser
Species Human (GRCh38)
Location 5:11925754-11925776
Sequence CTCATCTGTGATTCTTACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986860914_986860918 25 Left 986860914 5:11925754-11925776 CCCTAGTAAGAATCACAGATGAG No data
Right 986860918 5:11925802-11925824 TCTTGCAAGAGTGATTGCTCAGG No data
986860914_986860917 -6 Left 986860914 5:11925754-11925776 CCCTAGTAAGAATCACAGATGAG No data
Right 986860917 5:11925771-11925793 GATGAGGTAATCTGCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986860914 Original CRISPR CTCATCTGTGATTCTTACTA GGG (reversed) Intergenic
No off target data available for this crispr