ID: 986863327

View in Genome Browser
Species Human (GRCh38)
Location 5:11953346-11953368
Sequence CTCCACATACAAATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986863327_986863330 20 Left 986863327 5:11953346-11953368 CCTTTGTCCATTTGTATGTGGAG No data
Right 986863330 5:11953389-11953411 TTATTAGTGATATCATCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986863327 Original CRISPR CTCCACATACAAATGGACAA AGG (reversed) Intergenic
No off target data available for this crispr