ID: 986865731

View in Genome Browser
Species Human (GRCh38)
Location 5:11984383-11984405
Sequence GTCAACTGGAAAATGACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986865730_986865731 -10 Left 986865730 5:11984370-11984392 CCATATTTTGGAAGTCAACTGGA No data
Right 986865731 5:11984383-11984405 GTCAACTGGAAAATGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986865731 Original CRISPR GTCAACTGGAAAATGACACA TGG Intergenic
No off target data available for this crispr