ID: 986870769

View in Genome Browser
Species Human (GRCh38)
Location 5:12043087-12043109
Sequence CAGCTACCTTACCCTGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986870763_986870769 15 Left 986870763 5:12043049-12043071 CCAATTTATCTACATCTGTACCA No data
Right 986870769 5:12043087-12043109 CAGCTACCTTACCCTGCACTTGG No data
986870764_986870769 -5 Left 986870764 5:12043069-12043091 CCACCACCTGCCTAGTACCAGCT No data
Right 986870769 5:12043087-12043109 CAGCTACCTTACCCTGCACTTGG No data
986870765_986870769 -8 Left 986870765 5:12043072-12043094 CCACCTGCCTAGTACCAGCTACC No data
Right 986870769 5:12043087-12043109 CAGCTACCTTACCCTGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986870769 Original CRISPR CAGCTACCTTACCCTGCACT TGG Intergenic
No off target data available for this crispr