ID: 986871202

View in Genome Browser
Species Human (GRCh38)
Location 5:12048832-12048854
Sequence GACCCACAGTTCCCCAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986871202_986871204 27 Left 986871202 5:12048832-12048854 CCAGCCTTGGGGAACTGTGGGTC No data
Right 986871204 5:12048882-12048904 TCTTTCTTTTTTTTTTTGAGAGG 0: 13
1: 167
2: 2391
3: 6027
4: 27989
986871202_986871205 30 Left 986871202 5:12048832-12048854 CCAGCCTTGGGGAACTGTGGGTC No data
Right 986871205 5:12048885-12048907 TTCTTTTTTTTTTTGAGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986871202 Original CRISPR GACCCACAGTTCCCCAAGGC TGG (reversed) Intergenic
No off target data available for this crispr