ID: 986874261

View in Genome Browser
Species Human (GRCh38)
Location 5:12087889-12087911
Sequence TATTCATTCATTAAACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986874255_986874261 -6 Left 986874255 5:12087872-12087894 CCAACCTAAGTACCCATTATTCA No data
Right 986874261 5:12087889-12087911 TATTCATTCATTAAACTGGGTGG No data
986874256_986874261 -10 Left 986874256 5:12087876-12087898 CCTAAGTACCCATTATTCATTCA No data
Right 986874261 5:12087889-12087911 TATTCATTCATTAAACTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986874261 Original CRISPR TATTCATTCATTAAACTGGG TGG Intergenic
No off target data available for this crispr