ID: 986875766

View in Genome Browser
Species Human (GRCh38)
Location 5:12106769-12106791
Sequence CAGGTTAAAAGCAGAATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986875761_986875766 20 Left 986875761 5:12106726-12106748 CCACATCACAGTATTATTGTAAT No data
Right 986875766 5:12106769-12106791 CAGGTTAAAAGCAGAATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986875766 Original CRISPR CAGGTTAAAAGCAGAATTCT GGG Intergenic
No off target data available for this crispr