ID: 986876890

View in Genome Browser
Species Human (GRCh38)
Location 5:12122271-12122293
Sequence CAGTTGTCCTAAAGGGCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986876890_986876895 20 Left 986876890 5:12122271-12122293 CCTCATGCCCTTTAGGACAACTG No data
Right 986876895 5:12122314-12122336 GTCTTCTCACGAACTTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986876890 Original CRISPR CAGTTGTCCTAAAGGGCATG AGG (reversed) Intergenic
No off target data available for this crispr