ID: 986877859

View in Genome Browser
Species Human (GRCh38)
Location 5:12132619-12132641
Sequence CCTGTAGTCCAGATGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986877859_986877862 7 Left 986877859 5:12132619-12132641 CCAGGAAGCATCTGGACTACAGG No data
Right 986877862 5:12132649-12132671 TCCCCACCCACCCCTGACACTGG No data
986877859_986877869 17 Left 986877859 5:12132619-12132641 CCAGGAAGCATCTGGACTACAGG No data
Right 986877869 5:12132659-12132681 CCCCTGACACTGGTAGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986877859 Original CRISPR CCTGTAGTCCAGATGCTTCC TGG (reversed) Intergenic
No off target data available for this crispr