ID: 986878629

View in Genome Browser
Species Human (GRCh38)
Location 5:12142201-12142223
Sequence TAGTATGACTTTAAAGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986878628_986878629 21 Left 986878628 5:12142157-12142179 CCTGTGTATACTACAAAATAGTT No data
Right 986878629 5:12142201-12142223 TAGTATGACTTTAAAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986878629 Original CRISPR TAGTATGACTTTAAAGAAAA TGG Intergenic
No off target data available for this crispr