ID: 986885148

View in Genome Browser
Species Human (GRCh38)
Location 5:12225574-12225596
Sequence TATGCTGACTGTAGAGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986885148_986885154 18 Left 986885148 5:12225574-12225596 CCTAGGGCTCTACAGTCAGCATA No data
Right 986885154 5:12225615-12225637 AGGCTTGGGTCCTCCTCTTCAGG No data
986885148_986885150 -2 Left 986885148 5:12225574-12225596 CCTAGGGCTCTACAGTCAGCATA No data
Right 986885150 5:12225595-12225617 TATGGTGAATGAAGCTAGCCAGG No data
986885148_986885156 22 Left 986885148 5:12225574-12225596 CCTAGGGCTCTACAGTCAGCATA No data
Right 986885156 5:12225619-12225641 TTGGGTCCTCCTCTTCAGGGTGG No data
986885148_986885151 3 Left 986885148 5:12225574-12225596 CCTAGGGCTCTACAGTCAGCATA No data
Right 986885151 5:12225600-12225622 TGAATGAAGCTAGCCAGGCTTGG No data
986885148_986885155 19 Left 986885148 5:12225574-12225596 CCTAGGGCTCTACAGTCAGCATA No data
Right 986885155 5:12225616-12225638 GGCTTGGGTCCTCCTCTTCAGGG No data
986885148_986885152 4 Left 986885148 5:12225574-12225596 CCTAGGGCTCTACAGTCAGCATA No data
Right 986885152 5:12225601-12225623 GAATGAAGCTAGCCAGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986885148 Original CRISPR TATGCTGACTGTAGAGCCCT AGG (reversed) Intergenic
No off target data available for this crispr