ID: 986885156

View in Genome Browser
Species Human (GRCh38)
Location 5:12225619-12225641
Sequence TTGGGTCCTCCTCTTCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986885148_986885156 22 Left 986885148 5:12225574-12225596 CCTAGGGCTCTACAGTCAGCATA No data
Right 986885156 5:12225619-12225641 TTGGGTCCTCCTCTTCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986885156 Original CRISPR TTGGGTCCTCCTCTTCAGGG TGG Intergenic
No off target data available for this crispr