ID: 986886677

View in Genome Browser
Species Human (GRCh38)
Location 5:12246313-12246335
Sequence CCGTTCCCTTGCCATTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986886677_986886679 13 Left 986886677 5:12246313-12246335 CCAGCATAATGGCAAGGGAACGG No data
Right 986886679 5:12246349-12246371 ATTCCTGATCAATAAATGTGTGG No data
986886677_986886681 24 Left 986886677 5:12246313-12246335 CCAGCATAATGGCAAGGGAACGG No data
Right 986886681 5:12246360-12246382 ATAAATGTGTGGTGACAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986886677 Original CRISPR CCGTTCCCTTGCCATTATGC TGG (reversed) Intergenic
No off target data available for this crispr