ID: 986887348

View in Genome Browser
Species Human (GRCh38)
Location 5:12256134-12256156
Sequence TGGAAAAAAGCAGTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986887348_986887354 2 Left 986887348 5:12256134-12256156 CCTTCCTCCACTGCTTTTTTCCA No data
Right 986887354 5:12256159-12256181 AAGGTCCTCAAAGGATTGAACGG No data
986887348_986887357 23 Left 986887348 5:12256134-12256156 CCTTCCTCCACTGCTTTTTTCCA No data
Right 986887357 5:12256180-12256202 GGTGCCCACCCACATTGAGGAGG No data
986887348_986887356 20 Left 986887348 5:12256134-12256156 CCTTCCTCCACTGCTTTTTTCCA No data
Right 986887356 5:12256177-12256199 AACGGTGCCCACCCACATTGAGG No data
986887348_986887352 -7 Left 986887348 5:12256134-12256156 CCTTCCTCCACTGCTTTTTTCCA No data
Right 986887352 5:12256150-12256172 TTTTCCATTAAGGTCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986887348 Original CRISPR TGGAAAAAAGCAGTGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr