ID: 986888228

View in Genome Browser
Species Human (GRCh38)
Location 5:12266640-12266662
Sequence GACACTTTAGTCACAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986888228_986888231 8 Left 986888228 5:12266640-12266662 CCAGCTTTTGTGACTAAAGTGTC No data
Right 986888231 5:12266671-12266693 TCCGGACAAGTCAGGATTTGTGG No data
986888228_986888229 -10 Left 986888228 5:12266640-12266662 CCAGCTTTTGTGACTAAAGTGTC No data
Right 986888229 5:12266653-12266675 CTAAAGTGTCACTTTTACTCCGG No data
986888228_986888234 29 Left 986888228 5:12266640-12266662 CCAGCTTTTGTGACTAAAGTGTC No data
Right 986888234 5:12266692-12266714 GGCAGAGACCTTTCTGCTCTGGG No data
986888228_986888230 0 Left 986888228 5:12266640-12266662 CCAGCTTTTGTGACTAAAGTGTC No data
Right 986888230 5:12266663-12266685 ACTTTTACTCCGGACAAGTCAGG No data
986888228_986888233 28 Left 986888228 5:12266640-12266662 CCAGCTTTTGTGACTAAAGTGTC No data
Right 986888233 5:12266691-12266713 TGGCAGAGACCTTTCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986888228 Original CRISPR GACACTTTAGTCACAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr