ID: 986888333

View in Genome Browser
Species Human (GRCh38)
Location 5:12267904-12267926
Sequence CATAGCTTCCACTTCTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986888327_986888333 18 Left 986888327 5:12267863-12267885 CCCCAGTGTGTGTTGTTCCTCTC 0: 135
1: 1520
2: 4428
3: 9668
4: 18718
Right 986888333 5:12267904-12267926 CATAGCTTCCACTTCTAAGTGGG No data
986888325_986888333 29 Left 986888325 5:12267852-12267874 CCTCCGATAGGCCCCAGTGTGTG 0: 49
1: 947
2: 3930
3: 8035
4: 10862
Right 986888333 5:12267904-12267926 CATAGCTTCCACTTCTAAGTGGG No data
986888328_986888333 17 Left 986888328 5:12267864-12267886 CCCAGTGTGTGTTGTTCCTCTCT 0: 69
1: 833
2: 2504
3: 6386
4: 12347
Right 986888333 5:12267904-12267926 CATAGCTTCCACTTCTAAGTGGG No data
986888330_986888333 1 Left 986888330 5:12267880-12267902 CCTCTCTATGTGTCCATGTGTTC 0: 607
1: 1749
2: 7383
3: 17723
4: 17818
Right 986888333 5:12267904-12267926 CATAGCTTCCACTTCTAAGTGGG No data
986888329_986888333 16 Left 986888329 5:12267865-12267887 CCAGTGTGTGTTGTTCCTCTCTA 0: 49
1: 544
2: 1322
3: 2926
4: 7113
Right 986888333 5:12267904-12267926 CATAGCTTCCACTTCTAAGTGGG No data
986888326_986888333 26 Left 986888326 5:12267855-12267877 CCGATAGGCCCCAGTGTGTGTTG 0: 209
1: 1099
2: 2622
3: 3077
4: 3123
Right 986888333 5:12267904-12267926 CATAGCTTCCACTTCTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986888333 Original CRISPR CATAGCTTCCACTTCTAAGT GGG Intergenic
No off target data available for this crispr