ID: 986893044

View in Genome Browser
Species Human (GRCh38)
Location 5:12332348-12332370
Sequence CACTTTGGGCACGTGTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2700
Summary {0: 2, 1: 60, 2: 535, 3: 846, 4: 1257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986893044_986893052 10 Left 986893044 5:12332348-12332370 CCTGAGAACACGTGCCCAAAGTG 0: 2
1: 60
2: 535
3: 846
4: 1257
Right 986893052 5:12332381-12332403 AGCTTGGTTTTATATATTTTAGG 0: 108
1: 876
2: 1412
3: 1153
4: 1257
986893044_986893053 11 Left 986893044 5:12332348-12332370 CCTGAGAACACGTGCCCAAAGTG 0: 2
1: 60
2: 535
3: 846
4: 1257
Right 986893053 5:12332382-12332404 GCTTGGTTTTATATATTTTAGGG 0: 101
1: 849
2: 1361
3: 1147
4: 1212
986893044_986893051 -6 Left 986893044 5:12332348-12332370 CCTGAGAACACGTGCCCAAAGTG 0: 2
1: 60
2: 535
3: 846
4: 1257
Right 986893051 5:12332365-12332387 AAAGTGGTCGGGGTGCAGCTTGG No data
986893044_986893054 21 Left 986893044 5:12332348-12332370 CCTGAGAACACGTGCCCAAAGTG 0: 2
1: 60
2: 535
3: 846
4: 1257
Right 986893054 5:12332392-12332414 ATATATTTTAGGGAAGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986893044 Original CRISPR CACTTTGGGCACGTGTTCTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr