ID: 986896653

View in Genome Browser
Species Human (GRCh38)
Location 5:12379157-12379179
Sequence GAGGGTGAAGGGTAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9283
Summary {0: 13, 1: 220, 2: 1105, 3: 2524, 4: 5421}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986896653_986896660 -10 Left 986896653 5:12379157-12379179 CCCTCCTCCTACCCTTCACCCTC 0: 13
1: 220
2: 1105
3: 2524
4: 5421
Right 986896660 5:12379170-12379192 CTTCACCCTCAAGTAGGCCCTGG 0: 16
1: 144
2: 335
3: 434
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986896653 Original CRISPR GAGGGTGAAGGGTAGGAGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr