ID: 986899360

View in Genome Browser
Species Human (GRCh38)
Location 5:12412895-12412917
Sequence GGTGCTCTACAACTCTGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986899348_986899360 24 Left 986899348 5:12412848-12412870 CCATCCAAGGGCCAAATTCTGGA No data
Right 986899360 5:12412895-12412917 GGTGCTCTACAACTCTGTGGCGG No data
986899355_986899360 -8 Left 986899355 5:12412880-12412902 CCCAAGAGCCCACATGGTGCTCT No data
Right 986899360 5:12412895-12412917 GGTGCTCTACAACTCTGTGGCGG No data
986899349_986899360 20 Left 986899349 5:12412852-12412874 CCAAGGGCCAAATTCTGGAATCA No data
Right 986899360 5:12412895-12412917 GGTGCTCTACAACTCTGTGGCGG No data
986899356_986899360 -9 Left 986899356 5:12412881-12412903 CCAAGAGCCCACATGGTGCTCTA No data
Right 986899360 5:12412895-12412917 GGTGCTCTACAACTCTGTGGCGG No data
986899354_986899360 -7 Left 986899354 5:12412879-12412901 CCCCAAGAGCCCACATGGTGCTC No data
Right 986899360 5:12412895-12412917 GGTGCTCTACAACTCTGTGGCGG No data
986899352_986899360 13 Left 986899352 5:12412859-12412881 CCAAATTCTGGAATCAGGGACCC No data
Right 986899360 5:12412895-12412917 GGTGCTCTACAACTCTGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986899360 Original CRISPR GGTGCTCTACAACTCTGTGG CGG Intergenic
No off target data available for this crispr