ID: 986903751

View in Genome Browser
Species Human (GRCh38)
Location 5:12468351-12468373
Sequence ACACATGCACTGTAGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986903738_986903751 20 Left 986903738 5:12468308-12468330 CCCACAAGTGCCCACCCCCATGC No data
Right 986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG No data
986903741_986903751 9 Left 986903741 5:12468319-12468341 CCACCCCCATGCTAACATCCCCA No data
Right 986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG No data
986903747_986903751 -9 Left 986903747 5:12468337-12468359 CCCCAATGGTGTGAACACATGCA No data
Right 986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG No data
986903743_986903751 5 Left 986903743 5:12468323-12468345 CCCCATGCTAACATCCCCAATGG No data
Right 986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG No data
986903740_986903751 10 Left 986903740 5:12468318-12468340 CCCACCCCCATGCTAACATCCCC No data
Right 986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG No data
986903748_986903751 -10 Left 986903748 5:12468338-12468360 CCCAATGGTGTGAACACATGCAC No data
Right 986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG No data
986903746_986903751 3 Left 986903746 5:12468325-12468347 CCATGCTAACATCCCCAATGGTG No data
Right 986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG No data
986903739_986903751 19 Left 986903739 5:12468309-12468331 CCACAAGTGCCCACCCCCATGCT No data
Right 986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG No data
986903745_986903751 4 Left 986903745 5:12468324-12468346 CCCATGCTAACATCCCCAATGGT No data
Right 986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG No data
986903742_986903751 6 Left 986903742 5:12468322-12468344 CCCCCATGCTAACATCCCCAATG No data
Right 986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986903751 Original CRISPR ACACATGCACTGTAGCTGGC AGG Intergenic
No off target data available for this crispr