ID: 986903771

View in Genome Browser
Species Human (GRCh38)
Location 5:12468470-12468492
Sequence GTGGCAGAGTGCACACTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986903771_986903777 19 Left 986903771 5:12468470-12468492 CCATTGAGTGTGCACTCTGCCAC No data
Right 986903777 5:12468512-12468534 CTGGCATATGTGAATAAGGATGG No data
986903771_986903773 0 Left 986903771 5:12468470-12468492 CCATTGAGTGTGCACTCTGCCAC No data
Right 986903773 5:12468493-12468515 ACTGCCACTGCCACTGCTGCTGG No data
986903771_986903776 15 Left 986903771 5:12468470-12468492 CCATTGAGTGTGCACTCTGCCAC No data
Right 986903776 5:12468508-12468530 GCTGCTGGCATATGTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986903771 Original CRISPR GTGGCAGAGTGCACACTCAA TGG (reversed) Intergenic
No off target data available for this crispr