ID: 986913070

View in Genome Browser
Species Human (GRCh38)
Location 5:12581507-12581529
Sequence GAGAATGTAAAATGTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986913068_986913070 29 Left 986913068 5:12581455-12581477 CCAAGATTTCTTGTTTGTTTTTA No data
Right 986913070 5:12581507-12581529 GAGAATGTAAAATGTGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986913070 Original CRISPR GAGAATGTAAAATGTGTAGA TGG Intergenic
No off target data available for this crispr