ID: 986918704

View in Genome Browser
Species Human (GRCh38)
Location 5:12659499-12659521
Sequence AGTTTGCAATGCCAGATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986918704_986918706 0 Left 986918704 5:12659499-12659521 CCCTACATCTGGCATTGCAAACT No data
Right 986918706 5:12659522-12659544 ACACAACTGCAAGAGAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986918704 Original CRISPR AGTTTGCAATGCCAGATGTA GGG (reversed) Intergenic
No off target data available for this crispr