ID: 986938334

View in Genome Browser
Species Human (GRCh38)
Location 5:12918780-12918802
Sequence AGTTACCTGAAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986938329_986938334 22 Left 986938329 5:12918735-12918757 CCAAAGCCCAGTAATAGGCCAAG 0: 17
1: 191
2: 171
3: 92
4: 154
Right 986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG No data
986938332_986938334 4 Left 986938332 5:12918753-12918775 CCAAGAGCTGTCTCTCAAAAGAA 0: 15
1: 201
2: 219
3: 189
4: 415
Right 986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG No data
986938328_986938334 25 Left 986938328 5:12918732-12918754 CCACCAAAGCCCAGTAATAGGCC 0: 13
1: 161
2: 162
3: 88
4: 160
Right 986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG No data
986938331_986938334 15 Left 986938331 5:12918742-12918764 CCAGTAATAGGCCAAGAGCTGTC 0: 17
1: 183
2: 194
3: 123
4: 177
Right 986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG No data
986938330_986938334 16 Left 986938330 5:12918741-12918763 CCCAGTAATAGGCCAAGAGCTGT 0: 16
1: 194
2: 203
3: 147
4: 222
Right 986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986938334 Original CRISPR AGTTACCTGAAGAAGATGGC AGG Intergenic
No off target data available for this crispr