ID: 986945834

View in Genome Browser
Species Human (GRCh38)
Location 5:13018239-13018261
Sequence AACCTTATGAAACTAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986945833_986945834 -5 Left 986945833 5:13018221-13018243 CCAACAATCATTTTTTGCAACCT No data
Right 986945834 5:13018239-13018261 AACCTTATGAAACTAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986945834 Original CRISPR AACCTTATGAAACTAGTGCA AGG Intergenic
No off target data available for this crispr