ID: 986959835

View in Genome Browser
Species Human (GRCh38)
Location 5:13199188-13199210
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986959835_986959841 26 Left 986959835 5:13199188-13199210 CCCTGCCATCTTCTGCAGTTAAC No data
Right 986959841 5:13199237-13199259 TGCCTGTTACTGGGCTTTCATGG No data
986959835_986959840 17 Left 986959835 5:13199188-13199210 CCCTGCCATCTTCTGCAGTTAAC No data
Right 986959840 5:13199228-13199250 TCAGCTCTTTGCCTGTTACTGGG No data
986959835_986959839 16 Left 986959835 5:13199188-13199210 CCCTGCCATCTTCTGCAGTTAAC No data
Right 986959839 5:13199227-13199249 GTCAGCTCTTTGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986959835 Original CRISPR GTTAACTGCAGAAGATGGCA GGG (reversed) Intergenic
No off target data available for this crispr