ID: 986959839

View in Genome Browser
Species Human (GRCh38)
Location 5:13199227-13199249
Sequence GTCAGCTCTTTGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986959835_986959839 16 Left 986959835 5:13199188-13199210 CCCTGCCATCTTCTGCAGTTAAC No data
Right 986959839 5:13199227-13199249 GTCAGCTCTTTGCCTGTTACTGG No data
986959837_986959839 11 Left 986959837 5:13199193-13199215 CCATCTTCTGCAGTTAACTACTC No data
Right 986959839 5:13199227-13199249 GTCAGCTCTTTGCCTGTTACTGG No data
986959836_986959839 15 Left 986959836 5:13199189-13199211 CCTGCCATCTTCTGCAGTTAACT No data
Right 986959839 5:13199227-13199249 GTCAGCTCTTTGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986959839 Original CRISPR GTCAGCTCTTTGCCTGTTAC TGG Intergenic
No off target data available for this crispr