ID: 986959841

View in Genome Browser
Species Human (GRCh38)
Location 5:13199237-13199259
Sequence TGCCTGTTACTGGGCTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986959838_986959841 -3 Left 986959838 5:13199217-13199239 CCTTTTGAGAGTCAGCTCTTTGC No data
Right 986959841 5:13199237-13199259 TGCCTGTTACTGGGCTTTCATGG No data
986959837_986959841 21 Left 986959837 5:13199193-13199215 CCATCTTCTGCAGTTAACTACTC No data
Right 986959841 5:13199237-13199259 TGCCTGTTACTGGGCTTTCATGG No data
986959836_986959841 25 Left 986959836 5:13199189-13199211 CCTGCCATCTTCTGCAGTTAACT No data
Right 986959841 5:13199237-13199259 TGCCTGTTACTGGGCTTTCATGG No data
986959835_986959841 26 Left 986959835 5:13199188-13199210 CCCTGCCATCTTCTGCAGTTAAC No data
Right 986959841 5:13199237-13199259 TGCCTGTTACTGGGCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986959841 Original CRISPR TGCCTGTTACTGGGCTTTCA TGG Intergenic
No off target data available for this crispr