ID: 986960334

View in Genome Browser
Species Human (GRCh38)
Location 5:13202889-13202911
Sequence GTGTCCAAGAAGAAGTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986960334_986960338 12 Left 986960334 5:13202889-13202911 CCATCAAACTTCTTCTTGGACAC No data
Right 986960338 5:13202924-13202946 ATACATCTTCTGTACCTAGGCGG No data
986960334_986960336 9 Left 986960334 5:13202889-13202911 CCATCAAACTTCTTCTTGGACAC No data
Right 986960336 5:13202921-13202943 TCCATACATCTTCTGTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986960334 Original CRISPR GTGTCCAAGAAGAAGTTTGA TGG (reversed) Intergenic
No off target data available for this crispr