ID: 986961054

View in Genome Browser
Species Human (GRCh38)
Location 5:13213350-13213372
Sequence AATTTTGACGGGAGCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986961054_986961059 -2 Left 986961054 5:13213350-13213372 CCTGCTCTGCTCCCGTCAAAATT No data
Right 986961059 5:13213371-13213393 TTCTTATAATGGGATTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986961054 Original CRISPR AATTTTGACGGGAGCAGAGC AGG (reversed) Intergenic
No off target data available for this crispr