ID: 986963142

View in Genome Browser
Species Human (GRCh38)
Location 5:13239559-13239581
Sequence CAACAGACATGCTGAAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986963142_986963147 29 Left 986963142 5:13239559-13239581 CCAGGGTTTCAGCATGTCTGTTG No data
Right 986963147 5:13239611-13239633 AGTTGCTCCTGAGGTTCTCAGGG No data
986963142_986963143 -6 Left 986963142 5:13239559-13239581 CCAGGGTTTCAGCATGTCTGTTG No data
Right 986963143 5:13239576-13239598 CTGTTGCTGCCATGTTAGACAGG No data
986963142_986963145 20 Left 986963142 5:13239559-13239581 CCAGGGTTTCAGCATGTCTGTTG No data
Right 986963145 5:13239602-13239624 CTCAGCAGCAGTTGCTCCTGAGG No data
986963142_986963146 28 Left 986963142 5:13239559-13239581 CCAGGGTTTCAGCATGTCTGTTG No data
Right 986963146 5:13239610-13239632 CAGTTGCTCCTGAGGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986963142 Original CRISPR CAACAGACATGCTGAAACCC TGG (reversed) Intergenic
No off target data available for this crispr