ID: 986963144

View in Genome Browser
Species Human (GRCh38)
Location 5:13239585-13239607
Sequence GCTGAGTAACCTGTCTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986963144_986963147 3 Left 986963144 5:13239585-13239607 CCATGTTAGACAGGTTACTCAGC No data
Right 986963147 5:13239611-13239633 AGTTGCTCCTGAGGTTCTCAGGG No data
986963144_986963146 2 Left 986963144 5:13239585-13239607 CCATGTTAGACAGGTTACTCAGC No data
Right 986963146 5:13239610-13239632 CAGTTGCTCCTGAGGTTCTCAGG No data
986963144_986963145 -6 Left 986963144 5:13239585-13239607 CCATGTTAGACAGGTTACTCAGC No data
Right 986963145 5:13239602-13239624 CTCAGCAGCAGTTGCTCCTGAGG No data
986963144_986963149 15 Left 986963144 5:13239585-13239607 CCATGTTAGACAGGTTACTCAGC No data
Right 986963149 5:13239623-13239645 GGTTCTCAGGGACCTAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986963144 Original CRISPR GCTGAGTAACCTGTCTAACA TGG (reversed) Intergenic
No off target data available for this crispr