ID: 986963145

View in Genome Browser
Species Human (GRCh38)
Location 5:13239602-13239624
Sequence CTCAGCAGCAGTTGCTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986963142_986963145 20 Left 986963142 5:13239559-13239581 CCAGGGTTTCAGCATGTCTGTTG No data
Right 986963145 5:13239602-13239624 CTCAGCAGCAGTTGCTCCTGAGG No data
986963144_986963145 -6 Left 986963144 5:13239585-13239607 CCATGTTAGACAGGTTACTCAGC No data
Right 986963145 5:13239602-13239624 CTCAGCAGCAGTTGCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986963145 Original CRISPR CTCAGCAGCAGTTGCTCCTG AGG Intergenic
No off target data available for this crispr