ID: 986963147

View in Genome Browser
Species Human (GRCh38)
Location 5:13239611-13239633
Sequence AGTTGCTCCTGAGGTTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986963144_986963147 3 Left 986963144 5:13239585-13239607 CCATGTTAGACAGGTTACTCAGC No data
Right 986963147 5:13239611-13239633 AGTTGCTCCTGAGGTTCTCAGGG No data
986963142_986963147 29 Left 986963142 5:13239559-13239581 CCAGGGTTTCAGCATGTCTGTTG No data
Right 986963147 5:13239611-13239633 AGTTGCTCCTGAGGTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986963147 Original CRISPR AGTTGCTCCTGAGGTTCTCA GGG Intergenic
No off target data available for this crispr