ID: 986963149

View in Genome Browser
Species Human (GRCh38)
Location 5:13239623-13239645
Sequence GGTTCTCAGGGACCTAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986963144_986963149 15 Left 986963144 5:13239585-13239607 CCATGTTAGACAGGTTACTCAGC No data
Right 986963149 5:13239623-13239645 GGTTCTCAGGGACCTAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986963149 Original CRISPR GGTTCTCAGGGACCTAAGAA AGG Intergenic
No off target data available for this crispr