ID: 986967112

View in Genome Browser
Species Human (GRCh38)
Location 5:13287421-13287443
Sequence CTCTTCCTCCAGATTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986967112_986967117 12 Left 986967112 5:13287421-13287443 CCAGGGGAAATCTGGAGGAAGAG No data
Right 986967117 5:13287456-13287478 AACCATGGAGAACAAGCAAATGG No data
986967112_986967118 13 Left 986967112 5:13287421-13287443 CCAGGGGAAATCTGGAGGAAGAG No data
Right 986967118 5:13287457-13287479 ACCATGGAGAACAAGCAAATGGG No data
986967112_986967120 14 Left 986967112 5:13287421-13287443 CCAGGGGAAATCTGGAGGAAGAG No data
Right 986967120 5:13287458-13287480 CCATGGAGAACAAGCAAATGGGG No data
986967112_986967115 -3 Left 986967112 5:13287421-13287443 CCAGGGGAAATCTGGAGGAAGAG No data
Right 986967115 5:13287441-13287463 GAGAGGACTTCCTGGAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986967112 Original CRISPR CTCTTCCTCCAGATTTCCCC TGG (reversed) Intergenic
No off target data available for this crispr