ID: 986967243

View in Genome Browser
Species Human (GRCh38)
Location 5:13288711-13288733
Sequence GCAGAGGCATGGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986967243_986967250 24 Left 986967243 5:13288711-13288733 CCCAGCTCCATCCATGCCTCTGC No data
Right 986967250 5:13288758-13288780 TATAGCTGCATAGTATTTCATGG 0: 15
1: 1024
2: 25979
3: 14151
4: 8350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986967243 Original CRISPR GCAGAGGCATGGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr