ID: 986967243 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:13288711-13288733 |
| Sequence | GCAGAGGCATGGATGGAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 986967243_986967250 | 24 | Left | 986967243 | 5:13288711-13288733 | CCCAGCTCCATCCATGCCTCTGC | No data | ||
| Right | 986967250 | 5:13288758-13288780 | TATAGCTGCATAGTATTTCATGG | 0: 15 1: 1024 2: 25979 3: 14151 4: 8350 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 986967243 | Original CRISPR | GCAGAGGCATGGATGGAGCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||