ID: 986971493

View in Genome Browser
Species Human (GRCh38)
Location 5:13342398-13342420
Sequence TCTGATATCCAGAGTCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986971492_986971493 -10 Left 986971492 5:13342385-13342407 CCATCAGACAAAGTCTGATATCC No data
Right 986971493 5:13342398-13342420 TCTGATATCCAGAGTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986971493 Original CRISPR TCTGATATCCAGAGTCTACA AGG Intergenic
No off target data available for this crispr