ID: 986972398

View in Genome Browser
Species Human (GRCh38)
Location 5:13352461-13352483
Sequence ATGAATCTTAATAAGTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986972398_986972402 19 Left 986972398 5:13352461-13352483 CCATCCTACTTATTAAGATTCAT No data
Right 986972402 5:13352503-13352525 ATTGTGAACACTGTTTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986972398 Original CRISPR ATGAATCTTAATAAGTAGGA TGG (reversed) Intergenic
No off target data available for this crispr