ID: 986972402

View in Genome Browser
Species Human (GRCh38)
Location 5:13352503-13352525
Sequence ATTGTGAACACTGTTTTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986972398_986972402 19 Left 986972398 5:13352461-13352483 CCATCCTACTTATTAAGATTCAT No data
Right 986972402 5:13352503-13352525 ATTGTGAACACTGTTTTGTAAGG No data
986972399_986972402 15 Left 986972399 5:13352465-13352487 CCTACTTATTAAGATTCATTTTC No data
Right 986972402 5:13352503-13352525 ATTGTGAACACTGTTTTGTAAGG No data
986972397_986972402 20 Left 986972397 5:13352460-13352482 CCCATCCTACTTATTAAGATTCA No data
Right 986972402 5:13352503-13352525 ATTGTGAACACTGTTTTGTAAGG No data
986972396_986972402 27 Left 986972396 5:13352453-13352475 CCAATGTCCCATCCTACTTATTA No data
Right 986972402 5:13352503-13352525 ATTGTGAACACTGTTTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986972402 Original CRISPR ATTGTGAACACTGTTTTGTA AGG Intergenic
No off target data available for this crispr