ID: 986976046

View in Genome Browser
Species Human (GRCh38)
Location 5:13395291-13395313
Sequence GCGCGCGCGCACGCGCGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986976046_986976047 4 Left 986976046 5:13395291-13395313 CCAGTGCGCGCGTGCGCGCGCGC No data
Right 986976047 5:13395318-13395340 ACACACACACACGCACACACAGG 0: 25
1: 1583
2: 2738
3: 4245
4: 6661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986976046 Original CRISPR GCGCGCGCGCACGCGCGCAC TGG (reversed) Intergenic
No off target data available for this crispr