ID: 986981515

View in Genome Browser
Species Human (GRCh38)
Location 5:13453322-13453344
Sequence TTCACTAATGTGACTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986981515_986981517 7 Left 986981515 5:13453322-13453344 CCAGGTGTAGTCACATTAGTGAA No data
Right 986981517 5:13453352-13453374 GCAAGCAAAATATTAATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986981515 Original CRISPR TTCACTAATGTGACTACACC TGG (reversed) Intergenic
No off target data available for this crispr