ID: 986982543

View in Genome Browser
Species Human (GRCh38)
Location 5:13465911-13465933
Sequence TGCTCAGGAAACCTCAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986982541_986982543 4 Left 986982541 5:13465884-13465906 CCATGCACTGGCATAGGGCTATG No data
Right 986982543 5:13465911-13465933 TGCTCAGGAAACCTCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986982543 Original CRISPR TGCTCAGGAAACCTCAGAAA AGG Intergenic
No off target data available for this crispr