ID: 987001650

View in Genome Browser
Species Human (GRCh38)
Location 5:13666264-13666286
Sequence CTTTCTTTACTCTAGGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987001650_987001657 29 Left 987001650 5:13666264-13666286 CCATGTACCTAGAGTAAAGAAAG No data
Right 987001657 5:13666316-13666338 TCTTCTGTCCCCTATTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987001650 Original CRISPR CTTTCTTTACTCTAGGTACA TGG (reversed) Intergenic
No off target data available for this crispr